Order Kazusa clone(s) from : ![]() |
Product ID | ORK00779 |
---|---|
Accession No | AB033072 |
Description | leucine rich repeat and fibronectin type III domain containing 2 |
Clone name | hh00149a |
Vector information | |
cDNA sequence | DNA sequence (3144 bp) Predicted protein sequence (832 aa) |
Flexi ORF Clone | FXC00779 |
Source | Human adult brain |
Rouge ID |
mKIAA1246
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 309 bp |
---|---|
Genome contig ID | gi89161210r_40367351 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 40467351 | 40663104 | 3 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 194 | 207 | PR00019 | Leucine-rich repeat |
IPR001611 | 239 | 252 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 120 | 140 | PF00560 | Leucine-rich repeat |
IPR001611 | 144 | 166 | PF00560 | Leucine-rich repeat | |
IPR001611 | 168 | 190 | PF00560 | Leucine-rich repeat | |
IPR001611 | 193 | 215 | PF00560 | Leucine-rich repeat | |
IPR001611 | 217 | 239 | PF00560 | Leucine-rich repeat | |
IPR001611 | 241 | 263 | PF00560 | Leucine-rich repeat | |
IPR013098 | 332 | 419 | PF07679 | Immunoglobulin I-set | |
IPR003961 | 461 | 536 | PF00041 | Fibronectin | |
HMMSmart | IPR003591 | 118 | 141 | SM00369 | Leucine-rich repeat |
IPR003591 | 142 | 165 | SM00369 | Leucine-rich repeat | |
IPR003591 | 166 | 189 | SM00369 | Leucine-rich repeat | |
IPR003591 | 191 | 214 | SM00369 | Leucine-rich repeat | |
IPR003591 | 215 | 238 | SM00369 | Leucine-rich repeat | |
IPR003591 | 239 | 263 | SM00369 | Leucine-rich repeat | |
IPR000483 | 285 | 330 | SM00082 | Cysteine-rich flanking region | |
IPR003599 | 338 | 420 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 344 | 409 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR007110 | 332 | 418 | PS50835 | Immunoglobulin-like |
IPR003961 | 461 | 553 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 574 | GGTMILVIGGIIVATLLVFIVIL | 596 | PRIMARY | 23 |
![]() |
Primer_f | GGAAAGAATCTCACTGGCAAG |
---|---|
Primer_r | CCATTGACAGGGAGACGAAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGAAAGAATCTCACTGGCAAG |
Primer_r | CCATTGACAGGGAGACGAAAC |
PCR product length | 85 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |