Order Kazusa clone(s) from : ![]() |
Product ID | ORK00587 |
---|---|
Accession No | AB014544 |
Description | TLR4 interactor with leucine-rich repeats |
Clone name | hj03618 |
Vector information | |
cDNA sequence | DNA sequence (4933 bp) Predicted protein sequence (887 aa) |
HaloTag ORF Clone |
FHC00587
![]() |
Flexi ORF Clone | FXC00587 |
Source | Human adult brain |
Rouge ID |
mKIAA0644
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 161 | 174 | PR00019 | Leucine-rich repeat |
IPR001611 | 376 | 389 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 160 | 182 | PF00560 | Leucine-rich repeat |
IPR001611 | 184 | 206 | PF00560 | Leucine-rich repeat | |
IPR001611 | 208 | 230 | PF00560 | Leucine-rich repeat | |
IPR001611 | 232 | 254 | PF00560 | Leucine-rich repeat | |
IPR001611 | 256 | 278 | PF00560 | Leucine-rich repeat | |
IPR001611 | 306 | 328 | PF00560 | Leucine-rich repeat | |
IPR001611 | 330 | 352 | PF00560 | Leucine-rich repeat | |
IPR001611 | 354 | 376 | PF00560 | Leucine-rich repeat | |
IPR001611 | 378 | 400 | PF00560 | Leucine-rich repeat | |
IPR001611 | 402 | 424 | PF00560 | Leucine-rich repeat | |
IPR000483 | 463 | 491 | PF01463 | Cysteine-rich flanking region | |
HMMSmart | IPR003591 | 158 | 181 | SM00369 | Leucine-rich repeat |
IPR003591 | 182 | 205 | SM00369 | Leucine-rich repeat | |
IPR003591 | 206 | 229 | SM00369 | Leucine-rich repeat | |
IPR003591 | 230 | 253 | SM00369 | Leucine-rich repeat | |
IPR003591 | 254 | 277 | SM00369 | Leucine-rich repeat | |
IPR003591 | 278 | 303 | SM00369 | Leucine-rich repeat | |
IPR003591 | 304 | 327 | SM00369 | Leucine-rich repeat | |
IPR003591 | 328 | 351 | SM00369 | Leucine-rich repeat | |
IPR003591 | 352 | 375 | SM00369 | Leucine-rich repeat | |
IPR003591 | 376 | 399 | SM00369 | Leucine-rich repeat | |
IPR003591 | 400 | 423 | SM00369 | Leucine-rich repeat | |
IPR000483 | 435 | 491 | SM00082 | Cysteine-rich flanking region |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 772 | QLLTLALLTVNALLVLLALAAWA | 794 | PRIMARY | 23 |
---|
![]() |
---|
![]() |
Primer_f | CCAGCAGGGTAATATTGAGTC |
---|---|
Primer_r | AAGTAGAACACAGATCCAGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCAGCAGGGTAATATTGAGTC |
Primer_r | AAGTAGAACACAGATCCAGGC |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |