Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00531 |
---|---|
Accession No | AB007876 |
Description | leucine rich repeat transmembrane neuronal 2 |
Clone name | hh00236 |
Vector information | |
cDNA sequence | DNA sequence (5572 bp) Predicted protein sequence (529 aa) |
HaloTag ORF Clone |
FHC00531
|
Flexi ORF Clone | FXC00531 |
Source | Human adult brain |
Rouge ID |
mKIAA0416
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 148 | 161 | PR00019 | Leucine-rich repeat |
IPR001611 | 193 | 206 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 99 | 121 | PF00560 | Leucine-rich repeat |
IPR001611 | 123 | 145 | PF00560 | Leucine-rich repeat | |
IPR001611 | 147 | 169 | PF00560 | Leucine-rich repeat | |
IPR001611 | 171 | 193 | PF00560 | Leucine-rich repeat | |
IPR001611 | 195 | 217 | PF00560 | Leucine-rich repeat | |
IPR001611 | 219 | 241 | PF00560 | Leucine-rich repeat | |
IPR001611 | 267 | 289 | PF00560 | Leucine-rich repeat | |
IPR001611 | 291 | 313 | PF00560 | Leucine-rich repeat | |
HMMSmart | IPR003591 | 97 | 120 | SM00369 | Leucine-rich repeat |
IPR003591 | 121 | 144 | SM00369 | Leucine-rich repeat | |
IPR003591 | 145 | 168 | SM00369 | Leucine-rich repeat | |
IPR003591 | 169 | 192 | SM00369 | Leucine-rich repeat | |
IPR003591 | 193 | 216 | SM00369 | Leucine-rich repeat | |
IPR003591 | 217 | 237 | SM00369 | Leucine-rich repeat | |
IPR003591 | 241 | 264 | SM00369 | Leucine-rich repeat | |
IPR003591 | 265 | 288 | SM00369 | Leucine-rich repeat | |
IPR003591 | 289 | 312 | SM00369 | Leucine-rich repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 21 | PLGAPMLAAIYAMSMVLKMLPAL | 43 | SECONDARY | 23 | 2 | 436 | VITGTMALLFSFFFIIFIVFIS | 457 | PRIMARY | 22 |
---|
RT-PCR |
---|
Primer_f | ATGAAAAGTATGCCCCCAAAC |
---|---|
Primer_r | CACTTCCTACACACAGCTATC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGAAAAGTATGCCCCCAAAC |
Primer_r | CACTTCCTACACACAGCTATC |
PCR product length | 185 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |