Gene/Protein Characteristic Table for KIAA0369
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04711
Accession No AB002367
Description doublecortin-like kinase 1
Clone name hh00177
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5703 bp)
Predicted protein sequence (794 aa)
Source Human adult brain
Rouge ID mKIAA0369 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5703 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 794 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_522657 0 100.0 doublecortin an...
Pan troglodytes
CAH70657 0 100.0 doublecortin an...
Homo sapiens
O15075 6e-208 96.3 Serine/threonin...
Homo sapiens
XP_849124 1e-207 96.1 similar to Seri...
Canis lupus fam...
XP_001495011 1.3e-207 99.9 similar to Seri...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051552 3.4e-30 52.7 KIAA1765
AB023185 1.2e-19 38.9 KIAA0968
AB023216 7.9e-15 31.5 KIAA0999
D79997 6.9e-14 35.2 KIAA0175
AB018324 7.1e-14 36.8 KIAA0781
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 455 711 PD000001 Protein kinase
HMMPfam IPR003533 139 203 PF03607 Doublecortin
IPR003533 268 329 PF03607 Doublecortin
IPR000719 455 712 PF00069 Protein kinase
HMMSmart IPR003533 117 208 SM00537 Doublecortin
IPR003533 246 334 SM00537 Doublecortin
IPR001245 455 710 SM00219 Tyrosine protein kinase
IPR002290 455 712 SM00220 Serine/threonine protein kinase
ProfileScan IPR003533 122 208 PS50309 Doublecortin
IPR003533 251 334 PS50309 Doublecortin
IPR000719 455 712 PS50011 Protein kinase
ScanRegExp IPR000719 461 488 PS00107 Protein kinase
IPR008271 572 584 PS00108 Serine/threonine protein kinase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f ACGTGTAAGTTAGATGAGGGC
Primer_r GCATCGTGTAAATCATCTCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name GeneBridge 4
Primer_f ACGTGTAAGTTAGATGAGGGC
Primer_r GCATCGTGTAAATCATCTCTG
PCR product length 189 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp