|
Order Kazusa clone(s) from : |
| Product ID | ORK04711 |
|---|---|
| Accession No | AB002367 |
| Description | doublecortin-like kinase 1 |
| Clone name | hh00177 |
| Vector information | |
| cDNA sequence | DNA sequence (5703 bp) Predicted protein sequence (794 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0369
by Kazusa Mouse cDNA Project
|
Length: 5703 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Length: 794 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR000719 | 455 | 711 | PD000001 | Protein kinase |
| HMMPfam | IPR003533 | 139 | 203 | PF03607 | Doublecortin |
| IPR003533 | 268 | 329 | PF03607 | Doublecortin | |
| IPR000719 | 455 | 712 | PF00069 | Protein kinase | |
| HMMSmart | IPR003533 | 117 | 208 | SM00537 | Doublecortin |
| IPR003533 | 246 | 334 | SM00537 | Doublecortin | |
| IPR001245 | 455 | 710 | SM00219 | Tyrosine protein kinase | |
| IPR002290 | 455 | 712 | SM00220 | Serine/threonine protein kinase | |
| ProfileScan | IPR003533 | 122 | 208 | PS50309 | Doublecortin |
| IPR003533 | 251 | 334 | PS50309 | Doublecortin | |
| IPR000719 | 455 | 712 | PS50011 | Protein kinase | |
| ScanRegExp | IPR000719 | 461 | 488 | PS00107 | Protein kinase |
| IPR008271 | 572 | 584 | PS00108 | Serine/threonine protein kinase |
RT-PCR
|
|---|
Experimental conditions| Primer_f | ACGTGTAAGTTAGATGAGGGC |
|---|---|
| Primer_r | GCATCGTGTAAATCATCTCTG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 13
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ACGTGTAAGTTAGATGAGGGC |
| Primer_r | GCATCGTGTAAATCATCTCTG |
| PCR product length | 189 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |