KIAA0375

Product ID	ORK00519
Accession No	AB002373
Description	RUN and SH3 domain containing 2, transcript variant 2
Clone name	hh00360s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5216 bp) Predicted protein sequence (1540 aa)
HaloTag ORF Clone	FHC00519
Flexi ORF Clone	FXC00519
Source	Human adult brain
Rouge ID	mKIAA0375 by Kazusa Mouse cDNA Project
Note	We replaced hh00360, former representative clones for KIAA0375 with hh00360s1. (2002/12/27)

Length: 5216 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	510 bp
Genome contig ID	gi89161216f_35380124
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ATTATACCTATTAATAAAAAAGGTGCTCAGCCTCC
Flanking genome sequence (171767 - 171816)	----+--------+--------+--------+--------+----* AAACCATTTTCTCTTTGTGTTCCCCCACCCTCCCACCCTCCCACCCACCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	35480120	35551889	12	99.6	Terminal No-hit

Length: 1540 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N2Y8	100.0	Iporin; Interac...	Homo sapiens
CAH70650	99.9	RUN and SH3 dom...	Homo sapiens
XP_001089960	97.8	RUN and SH3 dom...	Macaca mulatta
AAI41187	87.2	Rusc2 protein [...	Mus musculus
EDL02482	86.9	RUN and SH3 dom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	1476	1524	PD000066	Src homology-3
FPrintScan	IPR001452	1488	1503	PR00452	Src homology-3
FPrintScan	IPR001452	1516	1528	PR00452	Src homology-3
HMMPfam	IPR004012	1063	1199	PF02759	RUN
HMMPfam	IPR011511	1475	1528	PF07653	Variant SH3
HMMSmart	IPR004012	1129	1197	SM00593	RUN
HMMSmart	IPR001452	1474	1529	SM00326	Src homology-3
ProfileScan	IPR004012	1055	1199	PS50826	RUN
ProfileScan	IPR001452	1471	1530	PS50002	Src homology-3

Primer_f	CCTCCTCCCTCTTCTGATGAC
Primer_r	AAAGCCATCTACAGGGTTCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCTCCTCCCTCTTCTGATGAC
Primer_r	AAAGCCATCTACAGGGTTCCC
PCR product length	129 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles