Gene/Protein Characteristic Table for KIAA0549
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07194
Accession No AB011121
Description trafficking protein, kinesin binding 2
Clone name hh00779
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4745 bp)
Predicted protein sequence (469 aa)
Source Human adult brain
Rouge ID mKIAA0549 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4745 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 469 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAY24227 6.3e-166 100.0 unknown [Homo s...
Homo sapiens
O60296 6.5e-166 100.0 Trafficking kin...
Homo sapiens
BAB32501 6.5e-166 100.0 amyotrophic lat...
Homo sapiens
BAB32550 1.4e-165 99.8 amyotrophic lat...
Homo sapiens
AAH40668 2.8e-164 99.4 Trafficking pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB028965 7.8e-19 46.6 KIAA1042
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CTCCACATGCAACCCAACAGC
Primer_r AGATAGGGGCACAAAGAGCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f CTCCACATGCAACCCAACAGC
Primer_r AGATAGGGGCACAAAGAGCTG
PCR product length 165 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp