KIAA0552

Product ID	ORK00560
Accession No	AB011124
Description	leucine zipper, putative tumor suppressor family member 3
Clone name	hh00869
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5257 bp) Predicted protein sequence (709 aa)
HaloTag ORF Clone	FHC00560
Flexi ORF Clone	FXC00560
Source	Human adult brain
Rouge ID	mKIAA0552 by Kazusa Mouse cDNA Project

Length: 5257 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1827 bp
Genome contig ID	gi51511747r_2991273
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTCCTTTCCCAAAGAAATAAAACGGAAAAAGCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTGAGTGGTATTCTTTGGCCTGCTTGTGTCTTTGCAGGTGCGGGAGGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	3091273	3097207	3	99.2	Perfect prediction

Length: 709 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_525250	7.2e-190	99.9	ProSAPiP1 prote...	Pan troglodytes
XP_001115087	1.5e-189	99.6	ProSAPiP1 prote...	Macaca mulatta
XP_542921	4.6e-186	97.6	similar to ProS...	Canis lupus fam...
CAM13273	7.9e-183	94.4	ProSAPiP1 prote...	Mus musculus
EDL80205	7.4e-181	93.5	ProSAPiP1 prote...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058716	2.5e-22	38.9	KIAA1813
AB002339	1.5e-07	31.8	KIAA0341

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	474	675	PF06818	Fez1

Primer_f	GGTTCTAGGGCAGGTACAGTG
Primer_r	TGTGTGGCCTCTAACCCTCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGTTCTAGGGCAGGTACAGTG
Primer_r	TGTGTGGCCTCTAACCCTCTG
PCR product length	164 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles