KIAA0561

Product ID	ORK05934
Accession No	AB011133
Description	microtubule associated serine/threonine kinase 3
Clone name	hh01676
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5887 bp) Predicted protein sequence (1308 aa)
HaloTag ORF Clone	FHC05934
Flexi ORF Clone	FXC05934
Source	Human adult brain
Rouge ID	mKIAA0561 by Kazusa Mouse cDNA Project

Length: 5887 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1959 bp
Genome contig ID	gi42406306f_17993494
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCTGGAGCTGGCAGTGAATAAAAGCCCGTATTTAC
Flanking genome sequence (130002 - 130051)	----+--------+--------+--------+--------+----* AAAGATGAGCTCCAACGTCTGGATTTGTGAGGGGCTGAGAAAGGAGGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	18069605	18123494	26	99.6	Internal No-hit

Length: 1308 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60307	100.0	Microtubule-ass...	Homo sapiens
XP_001115216	96.5	microtubule ass...	Macaca mulatta
XP_512507	96.6	microtubule ass...	Pan troglodytes
EAW84657	99.9	hCG36884, isofo...	Homo sapiens
XP_533875	93.4	similar to micr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023190	5.7e-77	59.6	KIAA0973
AB002301	1e-50	58.8	KIAA0303
AB018350	7.9e-47	59.0	KIAA0807
AB032950	8e-10	31.2	KIAA1124
AB023182	2.8e-06	37.3	KIAA0965

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	366	639	PD000001	Protein kinase
HMMPfam	IPR015022	55	331	PF08926	Domain of unknown function DUF1908
	IPR000719	366	639	PF00069	Protein kinase
	IPR000961	657	702	PF00433	Protein kinase
	IPR001478	984	1034	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001245	366	625	SM00219	Tyrosine protein kinase
	IPR002290	366	639	SM00220	Serine/threonine protein kinase
	IPR001478	957	1037	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000719	366	639	PS50011	Protein kinase
ProfileScan	IPR001478	949	1037	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008271	485	497	PS00108	Serine/threonine protein kinase

Primer_f	CTTTTATTCACTGCCAGCTCC
Primer_r	TGCTTCCCTTTCTGAGTCCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTTTATTCACTGCCAGCTCC
Primer_r	TGCTTCCCTTTCTGAGTCCCC
PCR product length	110 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles