KIAA0858

Product ID	ORK00662
Accession No	AB020665
Description	LIM domain 7
Clone name	hh02535
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5510 bp) Predicted protein sequence (1557 aa)
Source	Human adult brain
Rouge ID	mKIAA0858 by Kazusa Mouse cDNA Project
Note	We replaced hk06460, former representative clones for KIAA0858 with hh02535. (2002/5/10)

Length: 5510 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	662 bp
Genome contig ID	gi51511729f_75132868
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CAATTGCATTTGTAAATAAACTTGCTGATGCATTT
Flanking genome sequence (197946 - 197995)	----+--------+--------+--------+--------+----* AACGAGTGGGTCGTCTTTTTCTTAGGTGTATGTGTCTGACCTCAGGCCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	75232868	75330812	27	99.8	Perfect prediction

Length: 1557 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WWI1	99.9	LIM domain only...	Homo sapiens
XP_001139990	99.5	LIM domain only...	Pan troglodytes
XP_001139733	99.5	LIM domain only...	Pan troglodytes
BAG09875	100.0	LIM domain only...	synthetic construct
NP_056667	99.9	LIM domain only...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029025	7.8e-20	28.9	KIAA1102

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	942	984	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	940	1012	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	929	1005	PS50106	PDZ/DHR/GLGF

Primer_f	ATAGACATGAAATAGTTGCTC
Primer_r	ATTCATTTATTCAACCACTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-