Gene/Protein Characteristic Table for KIAA0858
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00662
Accession No AB020665
Description LIM domain 7
Clone name hh02535
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5510 bp)
Predicted protein sequence (1557 aa)
Source Human adult brain
Rouge ID mKIAA0858 by Kazusa Mouse cDNA Project
Note We replaced hk06460, former representative clones for KIAA0858 with hh02535. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5510 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 662 bp
Genome contig ID gi51511729f_75132868
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAATTGCATTTGTAAATAAACTTGCTGATGCATTT
Flanking genome sequence
(197946 - 197995)
----+----*----+----*----+----*----+----*----+----*
AACGAGTGGGTCGTCTTTTTCTTAGGTGTATGTGTCTGACCTCAGGCCTT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 13 f 75232868 75330812 27 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1557 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8WWI1 0 99.9 LIM domain only...
Homo sapiens
XP_001139990 0 99.5 LIM domain only...
Pan troglodytes
XP_001139733 0 99.5 LIM domain only...
Pan troglodytes
BAG09875 0 100.0 LIM domain only...
synthetic construct
NP_056667 0 99.9 LIM domain only...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029025 7.8e-20 28.9 KIAA1102
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001478 942 984 PF00595 PDZ/DHR/GLGF
HMMSmart IPR001478 940 1012 SM00228 PDZ/DHR/GLGF
ProfileScan IPR001478 929 1005 PS50106 PDZ/DHR/GLGF
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f ATAGACATGAAATAGTTGCTC
Primer_r ATTCATTTATTCAACCACTGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp