Order Kazusa clone(s) from : ![]() |
Product ID | ORK01607 |
---|---|
Accession No | AB020630 |
Description | protein phosphatase 1, regulatory subunit 16B, transcript variant 1 |
Clone name | hh02763s1 |
Vector information | |
cDNA sequence | DNA sequence (6250 bp) Predicted protein sequence (578 aa) |
HaloTag ORF Clone |
FHC01607
![]() |
Flexi ORF Clone | FXC01607 |
Source | Human adult brain |
Note | We replaced hh02763, former representative clones for KIAA0823 with hh02763s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4357 bp |
---|---|
Genome contig ID | gi51511747f_36767762 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (217320 - 217369) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 36867762 | 36985080 | 11 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 145 | 157 | PR01415 | Ankyrin |
IPR002110 | 157 | 169 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 82 | 110 | PF00023 | Ankyrin |
IPR002110 | 111 | 143 | PF00023 | Ankyrin | |
IPR002110 | 144 | 176 | PF00023 | Ankyrin | |
IPR002110 | 239 | 271 | PF00023 | Ankyrin | |
IPR002110 | 272 | 304 | PF00023 | Ankyrin | |
HMMSmart | IPR002110 | 78 | 107 | SM00248 | Ankyrin |
IPR002110 | 111 | 140 | SM00248 | Ankyrin | |
IPR002110 | 144 | 173 | SM00248 | Ankyrin | |
IPR002110 | 239 | 268 | SM00248 | Ankyrin | |
IPR002110 | 272 | 301 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 78 | 304 | PS50297 | Ankyrin |
IPR002110 | 111 | 143 | PS50088 | Ankyrin | |
IPR002110 | 144 | 176 | PS50088 | Ankyrin | |
IPR002110 | 239 | 271 | PS50088 | Ankyrin | |
IPR002110 | 272 | 304 | PS50088 | Ankyrin |
![]() |
Primer_f | CTGAGGTAACTTCCACGTAGC |
---|---|
Primer_r | AAGCAACTCCAGGGACATGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |