KIAA0823

Product ID	ORK01607
Accession No	AB020630
Description	protein phosphatase 1, regulatory subunit 16B, transcript variant 1
Clone name	hh02763s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-3126) was subcloned upstream of the cDNA (3127-6250). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (6250 bp) Predicted protein sequence (578 aa)
HaloTag ORF Clone	FHC01607
Flexi ORF Clone	FXC01607
Source	Human adult brain
Note	We replaced hh02763, former representative clones for KIAA0823 with hh02763s1. (2002/5/10)

Length: 6250 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4357 bp
Genome contig ID	gi51511747f_36767762
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTTTTAATTAAAATTATTAAATTCCTTTTAATAAC
Flanking genome sequence (217320 - 217369)	----+--------+--------+--------+--------+----* ACCTGCTAGTGTGAGTGATTATTGCTGTGAGCTCACTTGAACAGTGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	36867762	36985080	11	99.2	Perfect prediction

Length: 578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96T49	100.0	Protein phospha...	Homo sapiens
XP_542995	97.2	similar to Prot...	Canis lupus fam...
Q95N27	96.8	Protein phospha...	Bos taurus
Q8VHQ3	96.3	Protein phospha...	Mus musculus
XP_001058014	95.8	similar to Prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020672	3e-20	29.2	KIAA0865
AB002377	3.4e-09	29.8	KIAA0379
AB018314	2.6e-08	36.6	KIAA0771
AB033076	1.7e-07	27.6	KIAA1250
AB014597	2.1e-07	24.7	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	145	157	PR01415	Ankyrin
FPrintScan	IPR002110	157	169	PR01415	Ankyrin
HMMPfam	IPR002110	82	110	PF00023	Ankyrin
	IPR002110	111	143	PF00023	Ankyrin
	IPR002110	144	176	PF00023	Ankyrin
	IPR002110	239	271	PF00023	Ankyrin
	IPR002110	272	304	PF00023	Ankyrin
HMMSmart	IPR002110	78	107	SM00248	Ankyrin
	IPR002110	111	140	SM00248	Ankyrin
	IPR002110	144	173	SM00248	Ankyrin
	IPR002110	239	268	SM00248	Ankyrin
	IPR002110	272	301	SM00248	Ankyrin
ProfileScan	IPR002110	78	304	PS50297	Ankyrin
	IPR002110	111	143	PS50088	Ankyrin
	IPR002110	144	176	PS50088	Ankyrin
	IPR002110	239	271	PS50088	Ankyrin
	IPR002110	272	304	PS50088	Ankyrin

Primer_f	CTGAGGTAACTTCCACGTAGC
Primer_r	AAGCAACTCCAGGGACATGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-