KIAA0924

Product ID	ORK00685
Accession No	AB023141
Description	zinc finger protein 652, transcript variant 2
Clone name	hh02883
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5428 bp) Predicted protein sequence (617 aa)
HaloTag ORF Clone	FHC00685
Flexi ORF Clone	FXC00685
Source	Human adult brain
Rouge ID	mKIAA0924 by Kazusa Mouse cDNA Project

Length: 5428 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3288 bp
Genome contig ID	gi51511734r_44627568
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTCCAGCCTGGGCAACAGAGCGAGACTCCATCTC
Flanking genome sequence (88605 - 88556)	----+--------+--------+--------+--------+----* TCAATAAATAAATAAATAAAGGAATAAATGAAAGAAGAACTGTTAAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	44716173	44794834	9	98.6	Internal No-hit

Length: 617 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2D9	1.9e-186	100.0	Zinc finger pro...	Homo sapiens
XP_001092787	1.1e-185	99.5	similar to zinc...	Macaca mulatta
BAF85356	4.7e-185	99.3	unnamed protein...	Homo sapiens
XP_001502436	7.8e-183	97.7	similar to Zinc...	Equus caballus
XP_548190	1.4e-180	96.7	similar to zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033016	6.6e-20	68.0	KIAA1190
AB075849	7.6e-16	40.2	KIAA1969
AB107355	8.3e-15	27.4	KIAA2033
AB046835	3e-14	36.8	KIAA1615
AB037770	3.3e-14	28.1	KIAA1349

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	452	475	PD000003	Zinc finger
HMMPfam	IPR007087	256	279	PF00096	Zinc finger
	IPR007087	283	306	PF00096	Zinc finger
	IPR007087	310	333	PF00096	Zinc finger
	IPR007087	340	362	PF00096	Zinc finger
	IPR007087	368	390	PF00096	Zinc finger
	IPR007087	396	418	PF00096	Zinc finger
	IPR007087	424	446	PF00096	Zinc finger
	IPR007087	452	474	PF00096	Zinc finger
	IPR007087	480	502	PF00096	Zinc finger
HMMSmart	IPR015880	256	279	SM00355	Zinc finger
	IPR015880	283	303	SM00355	Zinc finger
	IPR015880	310	333	SM00355	Zinc finger
	IPR015880	340	362	SM00355	Zinc finger
	IPR015880	368	390	SM00355	Zinc finger
	IPR015880	396	418	SM00355	Zinc finger
	IPR015880	424	446	SM00355	Zinc finger
	IPR015880	452	474	SM00355	Zinc finger
	IPR015880	480	500	SM00355	Zinc finger
ProfileScan	IPR007087	256	284	PS50157	Zinc finger
	IPR007087	283	310	PS50157	Zinc finger
	IPR007087	310	338	PS50157	Zinc finger
	IPR007087	340	367	PS50157	Zinc finger
	IPR007087	368	395	PS50157	Zinc finger
	IPR007087	396	423	PS50157	Zinc finger
	IPR007087	424	451	PS50157	Zinc finger
	IPR007087	452	479	PS50157	Zinc finger
	IPR007087	480	508	PS50157	Zinc finger
ScanRegExp	IPR007087	258	279	PS00028	Zinc finger
	IPR007087	312	333	PS00028	Zinc finger
	IPR007087	342	362	PS00028	Zinc finger
	IPR007087	370	390	PS00028	Zinc finger
	IPR007087	398	418	PS00028	Zinc finger
	IPR007087	426	446	PS00028	Zinc finger
	IPR007087	454	474	PS00028	Zinc finger

Primer_f	GTACACATTCTTTGAGCACCC
Primer_r	AATACTACAGGCTTGACCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACCACCATCCTTAACAGAAAC
Primer_r	ACCACAAGTCTCAAGTCAAGG
PCR product length	162 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles