Gene/Protein Characteristic Table for KIAA1281
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00796
Accession No AB033107
Description zinc finger protein 608
Clone name hh04108s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5646 bp)
Predicted protein sequence (1534 aa)
Flexi ORF Clone FXC00796
Source Human adult brain
Rouge ID mKIAA1281 by Kazusa Mouse cDNA Project
Note We replaced hh04108, former representative clones for KIAA1281 with hh04108s1. (2002/5/10)
Features of the cloned cDNA sequence
Description

Length: 5646 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 983 bp
Genome contig ID gi51511721r_123900526
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
GCAATCAGAATTAAAAAGTTTTTTTTTTTTTAAAT
Flanking genome sequence
(99983 - 99934)
----+----*----+----*----+----*----+----*----+----*
AATGGCTTCTTGTCTGTCTCATGTTATTTTCTACCTGGCTGATAGTCATT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 r 124000509 124108704 9 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 1534 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9ULD9 0 100.0 Zinc finger pro...
Homo sapiens
NP_065798 0 99.9 zinc finger pro...
Homo sapiens
XP_001155805 0 99.7 zinc finger pro...
Pan troglodytes
XP_001094294 0 99.2 similar to zinc...
Macaca mulatta
XP_001504551 0 97.0 similar to Zinc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002293 2.2e-11 43.4 KIAA0295
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR007087 577 600 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCACGTATGGCAGTAGCAAGC
Primer_r ACTCCTCTGTTACCTAATTCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f GCACGTATGGCAGTAGCAAGC
Primer_r ACTCCTCTGTTACCTAATTCC
PCR product length 156 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp