Order Kazusa clone(s) from : ![]() |
Product ID | ORK00796 |
---|---|
Accession No | AB033107 |
Description | zinc finger protein 608 |
Clone name | hh04108s1 |
Vector information | |
cDNA sequence | DNA sequence (5646 bp) Predicted protein sequence (1534 aa) |
HaloTag ORF Clone |
FHC00796
![]() |
Flexi ORF Clone | FXC00796 |
Source | Human adult brain |
Rouge ID |
mKIAA1281
by Kazusa Mouse cDNA Project
|
Note | We replaced hh04108, former representative clones for KIAA1281 with hh04108s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 983 bp |
---|---|
Genome contig ID | gi51511721r_123900526 |
PolyA signal sequence (ATTAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99983 - 99934) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 124000509 | 124108704 | 9 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR007087 | 577 | 600 | PS00028 | Zinc finger |
![]() |
Primer_f | GCACGTATGGCAGTAGCAAGC |
---|---|
Primer_r | ACTCCTCTGTTACCTAATTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCACGTATGGCAGTAGCAAGC |
Primer_r | ACTCCTCTGTTACCTAATTCC |
PCR product length | 156 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |