KIAA1281

Product ID	ORK00796
Accession No	AB033107
Description	zinc finger protein 608
Clone name	hh04108s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5646 bp) Predicted protein sequence (1534 aa)
HaloTag ORF Clone	FHC00796
Flexi ORF Clone	FXC00796
Source	Human adult brain
Rouge ID	mKIAA1281 by Kazusa Mouse cDNA Project
Note	We replaced hh04108, former representative clones for KIAA1281 with hh04108s1. (2002/5/10)

Length: 5646 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	983 bp
Genome contig ID	gi51511721r_123900526
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- GCAATCAGAATTAAAAAGTTTTTTTTTTTTTAAAT
Flanking genome sequence (99983 - 99934)	----+--------+--------+--------+--------+----* AATGGCTTCTTGTCTGTCTCATGTTATTTTCTACCTGGCTGATAGTCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	124000509	124108704	9	99.4	Perfect prediction

Length: 1534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD9	100.0	Zinc finger pro...	Homo sapiens
NP_065798	99.9	zinc finger pro...	Homo sapiens
XP_001155805	99.7	zinc finger pro...	Pan troglodytes
XP_001094294	99.2	similar to zinc...	Macaca mulatta
XP_001504551	97.0	similar to Zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002293	2.2e-11	43.4	KIAA0295

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR007087	577	600	PS00028	Zinc finger

Primer_f	GCACGTATGGCAGTAGCAAGC
Primer_r	ACTCCTCTGTTACCTAATTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCACGTATGGCAGTAGCAAGC
Primer_r	ACTCCTCTGTTACCTAATTCC
PCR product length	156 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles