KIAA1053

Product ID	ORK06724
Accession No	AB028976
Description	sterile alpha motif domain containing 4A
Clone name	hh05049
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5896 bp) Predicted protein sequence (508 aa)
Source	Human adult brain

Length: 5896 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4367 bp
Genome contig ID	gi51511730f_54138698
PolyA signal sequence (AATACA,-18)	+--------+--------+----*----+---- AGTGAAGGGAAATGATTAATACAAGGTTTTGTAAC
Flanking genome sequence (191083 - 191132)	----+--------+--------+--------+--------+----* ACTGGTGTGTCTTTTTCTTTTTTTCAACATACATGATTGAATAGAAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	54238698	54329779	10	99.3	Perfect prediction

Length: 508 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPU9	5e-195	100.0	Sterile alpha m...	Homo sapiens
AAI21175	5.7e-195	100.0	SAMD4A protein ...	Homo sapiens
XP_001161253	2.6e-194	99.4	sterile alpha m...	Pan troglodytes
BAB64436	9.5e-193	98.6	hypothetical pr...	Macaca fascicularis
XP_613436	1.3e-189	97.0	sterile alpha m...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	111	171	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	110	173	SM00454	Sterile alpha motif SAM

Primer_f	TCGTTTGAAGAGACACTGAGG
Primer_r	GAATAACATCTACAACCTTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-