KIAA0802

Product ID	ORK00130
Accession No	AB018345
Description	microtubule crosslinking factor 1
Clone name	hh07536
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hh07536 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGC GGACGCGTGG G) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6009 bp) Predicted protein sequence (1578 aa)
HaloTag ORF Clone	FHC00130
Flexi ORF Clone	FXC00130
Source	Human adult brain
Rouge ID	mKIAA0802 by Kazusa Mouse cDNA Project
Note	We replaced hh01783, former representative clones for KIAA0802 with hh07536. (1999/6/16)

Length: 6009 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1189 bp
Genome contig ID	gi51511735f_8597409
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTGATGAAGTAGAAATAAAGCCCTTCTGAGATGGC
Flanking genome sequence (225368 - 225417)	----+--------+--------+--------+--------+----* AGCATGTCTCGGTCTCTCATTTCACACACCCTCCATCTTTTCCTAAGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	8697409	8822775	15	99.5	Perfect prediction

Length: 1578 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01613	99.9	hCG38133, isofo...	Homo sapiens
CAX15676	82.9	novel protein (...	Mus musculus
XP_237548	83.0	similar to Temp...	Rattus norvegicus
CAX15677	80.0	novel protein (...	Mus musculus
AAH60225	81.3	RIKEN cDNA 1110...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020696	6.5e-11	35.5	KIAA0889

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TATACCGCTACTGTGTCCTCG
Primer_r	TCATACAGACCCAGAGGCATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 18

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTTCATCACGGTCTCATACAG
Primer_r	CGATGATCCAACAGCAACACC
PCR product length	167 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles