Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00625 |
---|---|
Accession No | AB018301 |
Description | adhesion G protein-coupled receptor F5, transcript variant 1 |
Clone name | hh15259 |
Vector information | |
cDNA sequence | DNA sequence (5655 bp) Predicted protein sequence (1370 aa) |
HaloTag ORF Clone |
FHC00625
|
Flexi ORF Clone | FXC00625 |
Source | Human adult brain |
Rouge ID |
mKIAA0758
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04615, former representative clones for KIAA0758 with hh15259. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1387 bp |
---|---|
Genome contig ID | gi89161210r_46828301 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 46928301 | 46997611 | 21 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR008078 | 84 | 102 | PR01695 | Ig-hepta receptor |
IPR008078 | 163 | 188 | PR01695 | Ig-hepta receptor | |
IPR008078 | 400 | 417 | PR01695 | Ig-hepta receptor | |
IPR008078 | 422 | 448 | PR01695 | Ig-hepta receptor | |
IPR008078 | 451 | 475 | PR01695 | Ig-hepta receptor | |
IPR008078 | 690 | 711 | PR01695 | Ig-hepta receptor | |
IPR008078 | 724 | 737 | PR01695 | Ig-hepta receptor | |
IPR000832 | 1038 | 1062 | PR00249 | GPCR | |
IPR008078 | 1062 | 1074 | PR01695 | Ig-hepta receptor | |
IPR000832 | 1112 | 1135 | PR00249 | GPCR | |
IPR008078 | 1136 | 1152 | PR01695 | Ig-hepta receptor | |
IPR008078 | 1178 | 1195 | PR01695 | Ig-hepta receptor | |
IPR000832 | 1197 | 1222 | PR00249 | GPCR | |
IPR008078 | 1223 | 1240 | PR01695 | Ig-hepta receptor | |
IPR000832 | 1241 | 1261 | PR00249 | GPCR | |
IPR000832 | 1272 | 1293 | PR00249 | GPCR | |
IPR008078 | 1296 | 1322 | PR01695 | Ig-hepta receptor | |
IPR008078 | 1324 | 1348 | PR01695 | Ig-hepta receptor | |
HMMPfam | IPR000082 | 191 | 290 | PF01390 | SEA |
IPR013151 | 310 | 376 | PF00047 | Immunoglobulin | |
IPR013151 | 509 | 571 | PF00047 | Immunoglobulin | |
IPR000203 | 974 | 1021 | PF01825 | GPS | |
IPR000832 | 1080 | 1297 | PF00002 | GPCR | |
HMMSmart | IPR003599 | 302 | 392 | SM00409 | Immunoglobulin subtype |
IPR003598 | 308 | 381 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 501 | 587 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 507 | 576 | SM00408 | Immunoglobulin subtype 2 | |
IPR000203 | 974 | 1026 | SM00303 | GPS | |
ProfileScan | IPR007110 | 291 | 376 | PS50835 | Immunoglobulin-like |
IPR007110 | 393 | 490 | PS50835 | Immunoglobulin-like | |
IPR007110 | 495 | 585 | PS50835 | Immunoglobulin-like | |
IPR000203 | 975 | 1026 | PS50221 | GPS | |
IPR000832 | 1036 | 1294 | PS50261 | GPCR | |
ScanRegExp | IPR013032 | 144 | 157 | PS01186 | EGF-like region |
IPR000832 | 1282 | 1297 | PS00650 | GPCR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 31 | TTLCLMFIVIYSSKAALNWNYES | 53 | SECONDARY | 23 | 2 | 1036 | LDIISYVGVGFSILSLAACLVVE | 1058 | PRIMARY | 23 | 3 | 1076 | TCIVNIAASLLVANTWFIVVAAI | 1098 | SECONDARY | 23 | 4 | 1114 | TFFIHFFYLSVFFWMLTLGLMLF | 1136 | PRIMARY | 23 | 5 | 1152 | KAIAFCLGYGCPLAISVITLGAT | 1174 | SECONDARY | 23 | 6 | 1198 | AFAIPALIIVVVNITITIVVITK | 1220 | PRIMARY | 23 | 7 | 1239 | FQISKSIGVLTPLLGLTWGFGLT | 1261 | SECONDARY | 23 | 8 | 1272 | HIIFAILNVFQGLFILLFGCLWD | 1294 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | ATTGTGGATACTGGCCCTTGG |
---|---|
Primer_r | CATTAGGAGCACAGAACAACC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATTGTGGATACTGGCCCTTGG |
Primer_r | CATTAGGAGCACAGAACAACC |
PCR product length | 178 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |