Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00527 |
---|---|
Accession No | AB002388 |
Description | zinc finger protein 536 |
Clone name | hj00075 |
Vector information | |
cDNA sequence | DNA sequence (4935 bp) Predicted protein sequence (1312 aa) |
HaloTag ORF Clone |
FHC00527
|
Flexi ORF Clone | FXC00527 |
Source | Human adult brain |
Rouge ID |
mKIAA0390
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 765 | 786 | PD000003 | Zinc finger |
HMMPfam | IPR007087 | 142 | 164 | PF00096 | Zinc finger |
IPR007087 | 170 | 192 | PF00096 | Zinc finger | |
IPR007087 | 286 | 309 | PF00096 | Zinc finger | |
IPR007087 | 312 | 335 | PF00096 | Zinc finger | |
IPR007087 | 357 | 379 | PF00096 | Zinc finger | |
IPR007087 | 385 | 407 | PF00096 | Zinc finger | |
IPR007087 | 643 | 665 | PF00096 | Zinc finger | |
IPR007087 | 763 | 785 | PF00096 | Zinc finger | |
IPR007087 | 791 | 813 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 142 | 164 | SM00355 | Zinc finger |
IPR015880 | 170 | 192 | SM00355 | Zinc finger | |
IPR015880 | 286 | 309 | SM00355 | Zinc finger | |
IPR015880 | 312 | 335 | SM00355 | Zinc finger | |
IPR015880 | 357 | 379 | SM00355 | Zinc finger | |
IPR015880 | 385 | 407 | SM00355 | Zinc finger | |
IPR015880 | 643 | 665 | SM00355 | Zinc finger | |
IPR015880 | 763 | 785 | SM00355 | Zinc finger | |
IPR015880 | 791 | 813 | SM00355 | Zinc finger | |
IPR015880 | 1013 | 1036 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 142 | 169 | PS50157 | Zinc finger |
IPR007087 | 170 | 192 | PS50157 | Zinc finger | |
IPR007087 | 286 | 314 | PS50157 | Zinc finger | |
IPR007087 | 357 | 384 | PS50157 | Zinc finger | |
IPR007087 | 385 | 412 | PS50157 | Zinc finger | |
IPR007087 | 643 | 670 | PS50157 | Zinc finger | |
IPR007087 | 763 | 790 | PS50157 | Zinc finger | |
IPR007087 | 791 | 818 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 144 | 164 | PS00028 | Zinc finger |
IPR007087 | 288 | 309 | PS00028 | Zinc finger | |
IPR007087 | 359 | 379 | PS00028 | Zinc finger | |
IPR007087 | 386 | 407 | PS00028 | Zinc finger | |
IPR007087 | 645 | 665 | PS00028 | Zinc finger | |
IPR007087 | 765 | 785 | PS00028 | Zinc finger |
RT-PCR |
---|
Primer_f | CAGCATACAGCACACTTAAAG |
---|---|
Primer_r | GTGCTTTGGAACAGAGTATTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGCATACAGCACACTTAAAG |
Primer_r | GTGCTTTGGAACAGAGTATTG |
PCR product length | 136 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |