KIAA0818

Product ID	ORK05967
Accession No	AB011542
Description	multiple EGF-like-domains 9
Clone name	hj00220
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5507 bp) Predicted protein sequence (375 aa)
Source	Human adult brain
Rouge ID	mKIAA0818 by Kazusa Mouse cDNA Project

Length: 5507 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4377 bp
Genome contig ID	gi89161216r_122302912
PolyA signal sequence (CATAAA,-21)	+--------+--------+----*----+---- CTTTCAGCCCACTTCATAAAAATCTTTGAACTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATTTATTGGCCATGTATTTTGTTTAAGTTCATTTAAAGAATGTTTTCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	122402912	122461596	5	99.1	Perfect prediction

Length: 375 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAA32470	2.4e-150	100.0	MEGF9 [Homo sap...	Homo sapiens
Q9H1U4	3.3e-150	100.0	Multiple epider...	Homo sapiens
AAI56249	3.4e-150	100.0	Multiple EGF-li...	synthetic construct
EAW87464	3.5e-150	100.0	hCG28560, isofo...	Homo sapiens
XP_520222	3.7e-149	99.2	EGF-like-domain...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067494	3.6e-14	33.9	KIAA1907
AB058677	4.3e-11	31.0	KIAA1781
AB011539	3.1e-10	31.5	KIAA0815
AB011105	3.4e-09	32.6	KIAA0533
D63483	8.3e-09	27.9	KIAA0149

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002049	1	24	PF00053	EGF-like
	IPR002049	27	71	PF00053	EGF-like
	IPR002049	74	119	PF00053	EGF-like
	IPR002049	143	168	PF00053	EGF-like
	IPR002049	173	222	PF00053	EGF-like
HMMSmart	IPR002049	27	71	SM00180	EGF-like
	IPR002049	74	119	SM00180	EGF-like
	IPR002049	122	170	SM00180	EGF-like
	IPR002049	173	222	SM00180	EGF-like
ProfileScan	IPR002049	1	26	PS50027	EGF-like
	IPR002049	27	73	PS50027	EGF-like
	IPR002049	74	121	PS50027	EGF-like
	IPR002049	122	172	PS50027	EGF-like
	IPR002049	173	224	PS50027	EGF-like
ScanRegExp	IPR013032	45	56	PS00022	EGF-like region
	IPR002049	45	76	PS01248	EGF-like
	IPR002049	90	124	PS01248	EGF-like
	IPR002049	144	175	PS01248	EGF-like
	IPR002049	195	222	PS01248	EGF-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	242	ASLTTSVPTPVINSTFTPTTLQT	264	SECONDARY	23
SOSUI2	2	286	FNIIILTVIIIVVVLLMGFVGAV	308	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	nakayama
Primer_f	ACATGAAACAACTCTGACCAC
Primer_r	TTATAGGCCGAGCAATTAGGG
PCR product length	264 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles