KIAA1160

Gene/Protein Characteristic Table for KIAA1160

Order Kazusa clone(s) from :

Product ID	ORK00191
Accession No	AB032986
Description	ISY1-RAB43 readthrough
Clone name	hj01067
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4869 bp) Predicted protein sequence (351 aa)
HaloTag ORF Clone	FHC00191
Flexi ORF Clone	FXC00191
Source	Human adult brain
Rouge ID	mKIAA1160 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4869 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3812 bp
Genome contig ID	gi89161205r_130189108
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ACACATTCCTAAACCATTAAACAGATTTCTATAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCCACTGCGCCCAGGACTGGTTCTCTGATCTTTGAGCCCAGAGGCGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	130289108	130362569	13	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ULR0	1.9e-112	100.0	Pre-mRNA-splici...	Homo sapiens
XP_849089	1.2e-106	96.1	similar to CG96...	Canis lupus fam...
XP_001094091	1.9e-101	99.7	similar to CG96...	Macaca mulatta
XP_001488868	6e-93	98.6	similar to ISY1...	Equus caballus
Q69ZQ2	1e-92	98.2	Pre-mRNA-splici...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009360	21	288	PF06246	Isy1-like splicing

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CTCAGGATGTTTCAAAGGCTC
Primer_r	TCTGTGACCCCAAATGGCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 3

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTCAGGATGTTTCAAAGGCTC
Primer_r	TCTGTGACCCCAAATGGCATG
PCR product length	170 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp