KIAA0640

Product ID	ORK00586
Accession No	AB014540
Description	SWAP switching B-cell complex 70kDa subunit, transcript variant 1
Clone name	hj03440
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4824 bp) Predicted protein sequence (603 aa)
HaloTag ORF Clone	FHC00586
Flexi ORF Clone	FXC00586
Source	Human adult brain
Rouge ID	mKIAA0640 by Kazusa Mouse cDNA Project

Length: 4824 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3011 bp
Genome contig ID	gi51511727f_9542248
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- AGTAAGAAAATTAAAAATACCAGAACATACACTTT
Flanking genome sequence (188835 - 188884)	----+--------+--------+--------+--------+----* AAACTGTCTGATTTAATAAAACAGTGGGGGGTAAAGTTGGGTGTATCTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	9642248	9731081	13	99.2	Internal No-hit

Length: 603 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF61403	2.5e-169	100.0	SWAP-70 homolog...	Homo sapiens
Q9UH65	3.8e-169	99.8	Switch-associat...	Homo sapiens
XP_001101388	1.9e-168	99.1	similar to SWA-...	Macaca mulatta
XP_542503	8.1e-166	95.0	similar to SWA-...	Canis lupus fam...
EDM17868	2.7e-162	94.9	SWAP complex pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	229	324	PF00169	Pleckstrin-like
HMMSmart	IPR001849	229	326	SM00233	Pleckstrin-like
ProfileScan	IPR002048	25	60	PS50222	Calcium-binding EF-hand
ProfileScan	IPR001849	228	324	PS50003	Pleckstrin-like

Primer_f	CATCTTGGTTTTCAGTGGCAC
Primer_r	AACACCTGATGACAAGCACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CATCTTGGTTTTCAGTGGCAC
Primer_r	AACACCTGATGACAAGCACTC
PCR product length	246 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles