Order Kazusa clone(s) from : ![]() |
Product ID | ORK06502 |
---|---|
Accession No | AB046840 |
Description | periaxin |
Clone name | hj04150 |
Vector information | |
cDNA sequence | DNA sequence (4790 bp) Predicted protein sequence (1398 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1620
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 200 bp |
---|---|
Genome contig ID | gi42406306r_45491513 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 45591513 | 45602035 | 4 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR004829 | 455 | 520 | PD153432 | Cell surface antigen |
IPR004829 | 531 | 594 | PD153432 | Cell surface antigen | |
IPR004829 | 642 | 700 | PD153432 | Cell surface antigen | |
IPR004829 | 730 | 784 | PD153432 | Cell surface antigen | |
HMMPfam | IPR001478 | 20 | 69 | PF00595 | PDZ/DHR/GLGF |
HMMSmart | IPR001478 | 30 | 102 | SM00228 | PDZ/DHR/GLGF |
ProfileScan | IPR001478 | 18 | 87 | PS50106 | PDZ/DHR/GLGF |
![]() |
Primer_f | TGCAATGCGCCGAGCCTTACA |
---|---|
Primer_r | AAAGGAGAACTCGACGTCAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | RH-map |
---|---|
Primer_f | ACAGCAGGCTACAGGGTTCAG |
Primer_r | AAAGACACCCTCACCCACCAG |
PCR product length | 96 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |