KIAA1621

Product ID	ORK00256
Accession No	AB046841
Description	protocadherin beta 16
Clone name	hj04505
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4998 bp) Predicted protein sequence (787 aa)
HaloTag ORF Clone	FHC00256
Flexi ORF Clone	FXC00256
Source	Human adult brain
Rouge ID	mKIAA1621 by Kazusa Mouse cDNA Project

Length: 4998 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1510 bp
Genome contig ID	gi51511721f_140441164
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTAATTCTGCAAGTTACTTTAAAGCTAATCTAAG
Flanking genome sequence (104996 - 105045)	----+--------+--------+--------+--------+----* AAAAAAAAAAACAAATTGCAAAGTATGAGTAAATTAAAGAAAACAATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	140541164	140546158	1	99.0	Perfect prediction

Length: 787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11344	100.0	protocadherin b...	synthetic construct
AAK21988	99.5	protocadherin b...	Homo sapiens
Q9NRJ7	99.4	Protocadherin b...	Homo sapiens
AAF81914	99.0	protocadherin 3...	Homo sapiens
AAH36062	98.7	Protocadherin b...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011160	3.5e-122	44.6	KIAA0588
AB002325	1.8e-121	44.6	KIAA0327
AB002343	4.9e-103	41.0	KIAA0345
AB053446	3.6e-52	33.2	KIAA1773
AB046782	1.3e-40	34.8	KIAA1562

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	84	103	PR00205	Cadherin
	IPR002126	253	282	PR00205	Cadherin
	IPR002126	325	337	PR00205	Cadherin
	IPR002126	337	356	PR00205	Cadherin
	IPR002126	460	473	PR00205	Cadherin
	IPR002126	520	546	PR00205	Cadherin
	IPR002126	554	571	PR00205	Cadherin
HMMPfam	IPR013164	40	123	PF08266	Cadherin
	IPR002126	209	244	PF00028	Cadherin
	IPR002126	258	349	PF00028	Cadherin
	IPR002126	363	453	PF00028	Cadherin
	IPR002126	467	563	PF00028	Cadherin
	IPR002126	591	674	PF00028	Cadherin
HMMSmart	IPR002126	166	251	SM00112	Cadherin
	IPR002126	275	356	SM00112	Cadherin
	IPR002126	379	460	SM00112	Cadherin
	IPR002126	484	570	SM00112	Cadherin
	IPR002126	600	681	SM00112	Cadherin
ProfileScan	IPR002126	45	144	PS50268	Cadherin
	IPR002126	145	253	PS50268	Cadherin
	IPR002126	254	358	PS50268	Cadherin
	IPR002126	359	462	PS50268	Cadherin
	IPR002126	463	572	PS50268	Cadherin
	IPR002126	587	685	PS50268	Cadherin
ScanRegExp	IPR002126	132	142	PS00232	Cadherin
	IPR002126	241	251	PS00232	Cadherin
	IPR002126	346	356	PS00232	Cadherin
	IPR002126	450	460	PS00232	Cadherin
	IPR002126	560	570	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	RQVLVFFVLLSLSGAGAELGSYS	45	SECONDARY	23
SOSUI2	2	700	YLVVALASVSSLFLFSVLLFVVV	722	PRIMARY	23

Primer_f	CGCCTGAGATAGTAGTTGCTG
Primer_r	AGTGCTCTCTCCGTTACCAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CGCCTGAGATAGTAGTTGCTG
Primer_r	AGTGCTCTCTCCGTTACCAAG
PCR product length	148 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles