KIAA0835

Product ID	ORK01126
Accession No	AB020642
Description	myelin transcription factor 1
Clone name	hj05861
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5533 bp) Predicted protein sequence (1167 aa)
HaloTag ORF Clone	FHC01126
Flexi ORF Clone	FXC01126
Source	Human adult brain
Rouge ID	mKIAA0835 by Kazusa Mouse cDNA Project

Length: 5533 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1803 bp
Genome contig ID	gi51511747f_62166271
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGGTGATTTCCTAATAAAAGTCCACTCTGACTGTG
Flanking genome sequence (177779 - 177828)	----+--------+--------+--------+--------+----* AATCGGTGCTGTGGTCTGTGGGGAGGACATTGTCTCCATTCTTGGTGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	62266271	62344048	23	99.7	Perfect prediction

Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q01538	100.0	Myelin transcri...	Homo sapiens
CAM20796	90.1	myelin transcri...	Mus musculus
Q8CFC2	90.8	Myelin transcri...	Mus musculus
XP_543112	89.2	similar to Myel...	Canis lupus fam...
EDL07462	90.8	myelin transcri...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028973	6.2e-142	100.0	KIAA1050
AB029029	2.5e-72	48.4	KIAA1106
AB011107	9.4e-61	45.4	KIAA0535

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	73	103	PF01530	Zinc finger
	IPR002515	485	515	PF01530	Zinc finger
	IPR002515	529	559	PF01530	Zinc finger
	IPR013681	606	820	PF08474	Myelin transcription factor 1
	IPR002515	843	873	PF01530	Zinc finger
	IPR002515	887	917	PF01530	Zinc finger
	IPR002515	936	966	PF01530	Zinc finger
	IPR002515	989	1019	PF01530	Zinc finger

Primer_f	AGGCTGTGCAGATGTGTATGG
Primer_r	TACCCTCTGACCTTGATGATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGCACTCCCTCACAGCAACAG
Primer_r	GGCACGGATAACAGCAAATGG
PCR product length	138 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles