Order Kazusa clone(s) from : ![]() |
Product ID | ORK01126 |
---|---|
Accession No | AB020642 |
Description | myelin transcription factor 1 |
Clone name | hj05861 |
Vector information | |
cDNA sequence | DNA sequence (5533 bp) Predicted protein sequence (1167 aa) |
Flexi ORF Clone | FXC01126 |
Source | Human adult brain |
Rouge ID |
mKIAA0835
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1803 bp |
---|---|
Genome contig ID | gi51511747f_62166271 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (177779 - 177828) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 62266271 | 62344048 | 23 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002515 | 73 | 103 | PF01530 | Zinc finger |
IPR002515 | 485 | 515 | PF01530 | Zinc finger | |
IPR002515 | 529 | 559 | PF01530 | Zinc finger | |
IPR013681 | 606 | 820 | PF08474 | Myelin transcription factor 1 | |
IPR002515 | 843 | 873 | PF01530 | Zinc finger | |
IPR002515 | 887 | 917 | PF01530 | Zinc finger | |
IPR002515 | 936 | 966 | PF01530 | Zinc finger | |
IPR002515 | 989 | 1019 | PF01530 | Zinc finger |
![]() |
Primer_f | AGGCTGTGCAGATGTGTATGG |
---|---|
Primer_r | TACCCTCTGACCTTGATGATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGCACTCCCTCACAGCAACAG |
Primer_r | GGCACGGATAACAGCAAATGG |
PCR product length | 138 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |