KIAA0965

Product ID	ORK00701
Accession No	AB023182
Description	serine/threonine kinase 38 like
Clone name	hj06174s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5181 bp) Predicted protein sequence (489 aa)
HaloTag ORF Clone	FHC00701
Flexi ORF Clone	FXC00701
Source	Human adult brain
Rouge ID	mKIAA0965 by Kazusa Mouse cDNA Project
Note	We replaced hj06174, former representative clones for KIAA0965 with hj06174s1. (2002/5/10)

Length: 5181 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3502 bp
Genome contig ID	gi89161190f_27188345
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATTGAAGGTAAGATAAGAATAAAAACTATGTTTAC
Flanking genome sequence (181812 - 181861)	----+--------+--------+--------+--------+----* AAAATTTCTGTTGATGAAGTTTTTTGGTTTTATTTTTGAGTTTTGAGATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	27288345	27370155	14	99.3	Terminal No-hit

Length: 489 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001099774	5.4e-188	99.6	similar to seri...	Macaca mulatta
XP_534857	3e-183	97.9	similar to seri...	Canis lupus fam...
Q9Y2H1	7.2e-179	100.0	Serine/threonin...	Homo sapiens
AAQ02530	7.3e-179	100.0	serine/threonin...	synthetic construct
AAI51310	2e-177	99.1	STK38L protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032950	2.5e-25	39.1	KIAA1124
AB014519	7.5e-24	40.5	KIAA0619
AB023190	4.7e-18	36.8	KIAA0973
AB011133	7.5e-18	37.3	KIAA0561
AB018350	1.1e-17	38.7	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	115	260	PD000001	Protein kinase
BlastProDom	IPR000719	299	408	PD000001	Protein kinase
HMMPfam	IPR000719	115	408	PF00069	Protein kinase
HMMPfam	IPR000961	426	472	PF00433	Protein kinase
HMMSmart	IPR001245	115	402	SM00219	Tyrosine protein kinase
	IPR002290	115	408	SM00220	Serine/threonine protein kinase
	IPR000961	409	470	SM00133	Protein kinase
ProfileScan	IPR000719	115	408	PS50011	Protein kinase
ScanRegExp	IPR000719	121	144	PS00107	Protein kinase
ScanRegExp	IPR008271	234	246	PS00108	Serine/threonine protein kinase

Primer_f	AGACACTTGGGACTACTAGAG
Primer_r	AACACCAAACTCAGTAGCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGACACTTGGGACTACTAGAG
Primer_r	AACACCAAACTCAGTAGCCTC
PCR product length	172 bp
PCR conditions	95 °C15 sec60 °C60 sec35 cycles