|
Order Kazusa clone(s) from : |
| Product ID | ORK01624 |
|---|---|
| Accession No | AB028996 |
| Description | myotubularin related protein 2, transcript variant 1 |
| Clone name | hj06550 |
| Vector information | |
| cDNA sequence | DNA sequence (4680 bp) Predicted protein sequence (675 aa) |
|
HaloTag ORF Clone |
FHC01624
|
| Flexi ORF Clone | FXC01624 |
| Source | Human adult brain |
| Rouge ID |
mKIAA1073
by Kazusa Mouse cDNA Project
|
Length: 4680 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2407 bp |
|---|---|
| Genome contig ID | gi51511727r_95105694 |
| PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 11 | r | 95205694 | 95297107 | 15 | 99.3 | Perfect prediction |
Length: 675 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR004182 | 100 | 171 | PF02893 | GRAM |
| IPR010569 | 266 | 383 | PF06602 | Myotubularin-related | |
| HMMSmart | IPR004182 | 103 | 171 | SM00568 | GRAM |
| IPR003595 | 397 | 545 | SM00404 | Protein-tyrosine phosphatase | |
| ProfileScan | IPR000387 | 418 | 465 | PS50056 | Protein-tyrosine phosphatase |
| ScanRegExp | IPR000387 | 447 | 459 | PS00383 | Protein-tyrosine phosphatase |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TTGGTTCAGTCTGTCTTGTGC |
|---|---|
| Primer_r | GGATGTCAGAGAAGGCAGTCG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 11
Experimental conditions| Panel name | UniGene |
|---|---|
| Primer_f | - |
| Primer_r | - |
| PCR product length | - |
| PCR conditions | - |