KIAA1117

Product ID	ORK04824
Accession No	AB029040
Description	dopey family member 1
Clone name	hj06748
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj06748 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4983 bp) Predicted protein sequence (1558 aa)
Source	Human adult brain
Rouge ID	mKIAA1117 by Kazusa Mouse cDNA Project
Note	We replaced hk07169, former representative clones for KIAA1117 with hj06748. (2002/12/27)

Length: 4983 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	304 bp
Genome contig ID	gi89161210f_83798717
PolyA signal sequence (AATATA,-26)	+--------+--------+----*----+---- AACCTGCAAAATATACACTACCCATTTTTTTTTTC
Flanking genome sequence (136194 - 136243)	----+--------+--------+--------+--------+----* CATTGGTTTCAGACTTGGTTCAATTAAGATTGGTTGGGGATTTTTCTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	83898717	83934909	22	100.0	Perfect prediction

Length: 1558 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW48676	100.0	dopey family me...	Homo sapiens
EAW48674	100.0	dopey family me...	Homo sapiens
Q5JWR5	100.0	Protein dopey-1.	Homo sapiens
AAI50620	99.9	DOPEY1 protein ...	Homo sapiens
XP_532215	96.5	similar to pad-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023150	1.7e-120	38.0	KIAA0933

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CAAATGTCTGAATGTGGCCTG
Primer_r	GGGTAGTGTATATTTTGCAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAATGTCTGAATGTGGCCTG
Primer_r	GGGTAGTGTATATTTTGCAGG
PCR product length	147 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles