Gene/Protein Characteristic Table for KIAA1084
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07482
Accession No AB029007
Description zinc finger protein 507
Clone name hj07515
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5546 bp)
Predicted protein sequence (778 aa)
Source Human adult brain
Rouge ID mKIAA1084 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5546 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 3018 bp
Genome contig ID gi42406306f_37428393
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAAGAATTATACATTGCATAGCACTTAAAAATTT
Flanking genome sequence
(114156 - 114205)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCTTTTCCTTTCTTGTTGCGTTGGTAGCTGACGTTTAGTGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 19 f 37528393 37542547 4 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 778 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAE45937 0 99.7 hypothetical pr...
Homo sapiens
Q8TCN5 0 100.0 Zinc finger pro...
Homo sapiens
XP_524202 0 99.3 hypothetical pr...
Pan troglodytes
BAF85215 0 99.6 unnamed protein...
Homo sapiens
Q5RDQ6 0 98.7 Zinc finger pro...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051490 4.9e-06 31.1 KIAA1703
AB040941 1.9e-05 40.5 KIAA1508
AB046835 2.3e-05 34.9 KIAA1615
D87073 2.4e-05 33.3 KIAA0236
AB037817 3e-05 28.7 KIAA1396
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 683 705 PF00096 Zinc finger
IPR007087 711 734 PF00096 Zinc finger
HMMSmart IPR015880 139 161 SM00355 Zinc finger
IPR015880 169 192 SM00355 Zinc finger
IPR015880 262 284 SM00355 Zinc finger
IPR015880 655 677 SM00355 Zinc finger
IPR015880 683 705 SM00355 Zinc finger
IPR015880 711 734 SM00355 Zinc finger
ProfileScan IPR007087 655 682 PS50157 Zinc finger
IPR007087 711 739 PS50157 Zinc finger
ScanRegExp IPR007087 264 284 PS00028 Zinc finger
IPR007087 713 734 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GTTGTTGCAGAGTGAGTTTAG
Primer_r GACAGGTTACAGGGACAAAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 19
Experimental conditions
Panel name GeneBridge 4
Primer_f GTTGTTGCAGAGTGAGTTTAG
Primer_r GACAGGTTACAGGGACAAAGG
PCR product length 113 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp