Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07482 |
---|---|
Accession No | AB029007 |
Description | zinc finger protein 507 |
Clone name | hj07515 |
Vector information | |
cDNA sequence | DNA sequence (5546 bp) Predicted protein sequence (778 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1084
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3018 bp |
---|---|
Genome contig ID | gi42406306f_37428393 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (114156 - 114205) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 37528393 | 37542547 | 4 | 99.4 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 683 | 705 | PF00096 | Zinc finger |
IPR007087 | 711 | 734 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 139 | 161 | SM00355 | Zinc finger |
IPR015880 | 169 | 192 | SM00355 | Zinc finger | |
IPR015880 | 262 | 284 | SM00355 | Zinc finger | |
IPR015880 | 655 | 677 | SM00355 | Zinc finger | |
IPR015880 | 683 | 705 | SM00355 | Zinc finger | |
IPR015880 | 711 | 734 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 655 | 682 | PS50157 | Zinc finger |
IPR007087 | 711 | 739 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 264 | 284 | PS00028 | Zinc finger |
IPR007087 | 713 | 734 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | GTTGTTGCAGAGTGAGTTTAG |
---|---|
Primer_r | GACAGGTTACAGGGACAAAGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTGTTGCAGAGTGAGTTTAG |
Primer_r | GACAGGTTACAGGGACAAAGG |
PCR product length | 113 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |