|
Order Kazusa clone(s) from : |
| Product ID | ORK07482 |
|---|---|
| Accession No | AB029007 |
| Description | zinc finger protein 507 |
| Clone name | hj07515 |
| Vector information | |
| cDNA sequence | DNA sequence (5546 bp) Predicted protein sequence (778 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA1084
by Kazusa Mouse cDNA Project
|
Length: 5546 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3018 bp |
|---|---|
| Genome contig ID | gi42406306f_37428393 |
| PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (114156 - 114205) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 19 | f | 37528393 | 37542547 | 4 | 99.4 | Perfect prediction |
Length: 778 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR007087 | 683 | 705 | PF00096 | Zinc finger |
| IPR007087 | 711 | 734 | PF00096 | Zinc finger | |
| HMMSmart | IPR015880 | 139 | 161 | SM00355 | Zinc finger |
| IPR015880 | 169 | 192 | SM00355 | Zinc finger | |
| IPR015880 | 262 | 284 | SM00355 | Zinc finger | |
| IPR015880 | 655 | 677 | SM00355 | Zinc finger | |
| IPR015880 | 683 | 705 | SM00355 | Zinc finger | |
| IPR015880 | 711 | 734 | SM00355 | Zinc finger | |
| ProfileScan | IPR007087 | 655 | 682 | PS50157 | Zinc finger |
| IPR007087 | 711 | 739 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 264 | 284 | PS00028 | Zinc finger |
| IPR007087 | 713 | 734 | PS00028 | Zinc finger |
RT-PCR-ELISA
|
Experimental conditions| Primer_f | GTTGTTGCAGAGTGAGTTTAG |
|---|---|
| Primer_r | GACAGGTTACAGGGACAAAGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 19
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GTTGTTGCAGAGTGAGTTTAG |
| Primer_r | GACAGGTTACAGGGACAAAGG |
| PCR product length | 113 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |