KIAA1084

Product ID	ORK07482
Accession No	AB029007
Description	zinc finger protein 507
Clone name	hj07515
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5546 bp) Predicted protein sequence (778 aa)
Source	Human adult brain
Rouge ID	mKIAA1084 by Kazusa Mouse cDNA Project

Length: 5546 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3018 bp
Genome contig ID	gi42406306f_37428393
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAAGAATTATACATTGCATAGCACTTAAAAATTT
Flanking genome sequence (114156 - 114205)	----+--------+--------+--------+--------+----* GCGGCCGCTTTTCCTTTCTTGTTGCGTTGGTAGCTGACGTTTAGTGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	37528393	37542547	4	99.4	Perfect prediction

Length: 778 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE45937	99.7	hypothetical pr...	Homo sapiens
Q8TCN5	100.0	Zinc finger pro...	Homo sapiens
XP_524202	99.3	hypothetical pr...	Pan troglodytes
BAF85215	99.6	unnamed protein...	Homo sapiens
Q5RDQ6	98.7	Zinc finger pro...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051490	4.9e-06	31.1	KIAA1703
AB040941	1.9e-05	40.5	KIAA1508
AB046835	2.3e-05	34.9	KIAA1615
D87073	2.4e-05	33.3	KIAA0236
AB037817	3e-05	28.7	KIAA1396

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	683	705	PF00096	Zinc finger
HMMPfam	IPR007087	711	734	PF00096	Zinc finger
HMMSmart	IPR015880	139	161	SM00355	Zinc finger
	IPR015880	169	192	SM00355	Zinc finger
	IPR015880	262	284	SM00355	Zinc finger
	IPR015880	655	677	SM00355	Zinc finger
	IPR015880	683	705	SM00355	Zinc finger
	IPR015880	711	734	SM00355	Zinc finger
ProfileScan	IPR007087	655	682	PS50157	Zinc finger
ProfileScan	IPR007087	711	739	PS50157	Zinc finger
ScanRegExp	IPR007087	264	284	PS00028	Zinc finger
ScanRegExp	IPR007087	713	734	PS00028	Zinc finger

Primer_f	GTTGTTGCAGAGTGAGTTTAG
Primer_r	GACAGGTTACAGGGACAAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTGTTGCAGAGTGAGTTTAG
Primer_r	GACAGGTTACAGGGACAAAGG
PCR product length	113 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles