Order Kazusa clone(s) from : ![]() |
Product ID | ORK04977 |
---|---|
Accession No | AB032990 |
Description | family with sequence similarity 63, member B |
Clone name | hk00541 |
Vector information | |
cDNA sequence | DNA sequence (4097 bp) Predicted protein sequence (390 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1164
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2923 bp |
---|---|
Genome contig ID | gi51511731f_56751576 |
PolyA signal sequence (AATAGA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (185450 - 185499) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 56851576 | 56937024 | 9 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007518 | 42 | 167 | PF04424 | Protein of unknown function DUF544 |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 35 | PCPLLAILNVLLLAWK | 50 | PRIMARY | 16 |
---|
![]() |
Primer_f | ACAATCTGGGAATAGTGAACG |
---|---|
Primer_r | TTAGGAAATCAGGCACAGACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACAATCTGGGAATAGTGAACG |
Primer_r | TTAGGAAATCAGGCACAGACG |
PCR product length | 194 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |