Order Kazusa clone(s) from : ![]() |
Product ID | ORK01114 |
---|---|
Accession No | AB018263 |
Description | pleckstrin homology domain containing, family G (with RhoGef domain) member 5, transcript variant 3 |
Clone name | hk01741s1 |
Vector information | |
cDNA sequence | DNA sequence (4749 bp) Predicted protein sequence (1091 aa) |
Flexi ORF Clone | FXC01114 |
Source | Human adult brain |
Rouge ID |
mKIAA0720
by Kazusa Mouse cDNA Project
|
Note | We replaced hk01741, former representative clones for KIAA0720 with hk01741s1. (1999/6/16) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1471 bp |
---|---|
Genome contig ID | gi89161185r_6348739 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 6448739 | 6480059 | 22 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | CCCTGGCTCTACCTTGAAGTG |
---|---|
Primer_r | GACAGGCCAAGTAGAACACGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCCTGGCTCTACCTTGAAGTG |
Primer_r | GACAGGCCAAGTAGAACACGC |
PCR product length | 130 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |