KIAA0682

Product ID	ORK00114
Accession No	AB014582
Description	RNA binding motif protein 19, transcript variant 2
Clone name	hk02879
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4422 bp) Predicted protein sequence (973 aa)
HaloTag ORF Clone	FHC00114
Flexi ORF Clone	FXC00114
Source	Human adult brain

Length: 4422 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1460 bp
Genome contig ID	gi89161190r_112638930
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTTTTCAGCCGTCTTAATAATAAAAGATTAATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGCTTGCATAATAATAATTTATTCACCCATGCCGCCTAGGCCATTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	112738930	112888494	25	99.4	Perfect prediction

Length: 973 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11228	100.0	RNA binding mot...	synthetic construct
Q9Y4C8	99.9	Probable RNA-bi...	Homo sapiens
BAF84133	99.5	unnamed protein...	Homo sapiens
CAB55987	99.4	hypothetical pr...	Homo sapiens
XP_522578	99.2	RNA binding mot...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	17	87	PF00076	RNA recognition motif
	IPR000504	309	377	PF00076	RNA recognition motif
	IPR000504	417	488	PF00076	RNA recognition motif
	IPR000504	745	819	PF00076	RNA recognition motif
	IPR000504	847	920	PF00076	RNA recognition motif
HMMSmart	IPR000504	16	88	SM00360	RNA recognition motif
	IPR000504	308	378	SM00360	RNA recognition motif
	IPR003954	416	489	SM00361	RNA recognition
	IPR000504	416	489	SM00360	RNA recognition motif
	IPR000504	601	668	SM00360	RNA recognition motif
	IPR003954	744	820	SM00361	RNA recognition
	IPR000504	744	820	SM00360	RNA recognition motif
	IPR000504	846	921	SM00360	RNA recognition motif
ProfileScan	IPR000504	15	92	PS50102	RNA recognition motif
	IPR000504	307	382	PS50102	RNA recognition motif
	IPR000504	415	493	PS50102	RNA recognition motif
	IPR000504	600	672	PS50102	RNA recognition motif
	IPR000504	743	824	PS50102	RNA recognition motif
	IPR000504	845	925	PS50102	RNA recognition motif

Primer_f	TGCCAGTCAAACGTTCAAAGG
Primer_r	AAGAGAAGTGGGTGGAAAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCCAGTCAAACGTTCAAAGG
Primer_r	AAGAGAAGTGGGTGGAAAAGC
PCR product length	167 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles