Gene/Protein Characteristic Table for KIAA0685
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00604
Accession No AB014585
Description protein phosphatase 6, regulatory subunit 2, transcript variant 4
Clone name hk02959
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3981 bp)
Predicted protein sequence (939 aa)
Flexi ORF Clone FXC00604
Source Human adult brain
Rouge ID mKIAA0685 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3981 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 939 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAO03456 0 100.0 SAPS domain fam...
Homo sapiens
AAH06568 0 99.8 SAPS domain fam...
Homo sapiens
AAH32664 0 99.7 SAPS domain fam...
Homo sapiens
AAH52995 0 96.7 SAPS2 protein [...
Homo sapiens
Q8R3Q2 0 81.9 Serine/threonin...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046778 1.1e-60 46.4 KIAA1558
AB029038 7.8e-40 42.1 KIAA1115
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007587 140 544 PF04499 SIT4 phosphatase-associated protein
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGTTGAAACCAGTTGGACGGC
Primer_r CGACCTTATTGCTGTGCTCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name GeneBridge 4
Primer_f AGTTGAAACCAGTTGGACGGC
Primer_r CGACCTTATTGCTGTGCTCTG
PCR product length 131 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp