Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00628 |
---|---|
Accession No | AB018306 |
Description | IQ motif and Sec7 domain 1 |
Clone name | hk04726 |
Vector information | |
cDNA sequence | DNA sequence (4148 bp) Predicted protein sequence (843 aa) |
HaloTag ORF Clone |
FHC00628
|
Flexi ORF Clone | FXC00628 |
Source | Human adult brain |
Rouge ID |
mKIAA0763
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1516 bp |
---|---|
Genome contig ID | gi89161205r_12814374 |
PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 12914374 | 12958170 | 13 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000048 | 15 | 35 | PF00612 | IQ calmodulin-binding region |
IPR000904 | 401 | 592 | PF01369 | SEC7-like | |
HMMSmart | IPR000904 | 401 | 592 | SM00222 | SEC7-like |
IPR001849 | 633 | 744 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000048 | 14 | 43 | PS50096 | IQ calmodulin-binding region |
IPR000904 | 397 | 590 | PS50190 | SEC7-like |
RT-PCR-ELISA |
Primer_f | AGCATGGGACCGTGTGATTGG |
---|---|
Primer_r | ACGCCAGATGACATGCAGCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGCATGGGACCGTGTGATTGG |
Primer_r | ACGCCAGATGACATGCAGCAG |
PCR product length | 179 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |