Order Kazusa clone(s) from : ![]() |
Product ID | ORK00653 |
---|---|
Accession No | AB020650 |
Description | actin binding LIM protein family, member 3, transcript variant 2 |
Clone name | hk05155 |
Vector information | |
cDNA sequence | DNA sequence (4256 bp) Predicted protein sequence (691 aa) |
HaloTag ORF Clone |
FHC00653
![]() |
Flexi ORF Clone | FXC00653 |
Source | Human adult brain |
Rouge ID |
mKIAA0843
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2032 bp |
---|---|
Genome contig ID | gi51511721f_148401326 |
PolyA signal sequence (CATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (218868 - 218917) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 148501326 | 148620192 | 23 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001781 | 31 | 85 | PD000094 | Zinc finger |
IPR001781 | 88 | 141 | PD000094 | Zinc finger | |
IPR001781 | 158 | 211 | PD000094 | Zinc finger | |
IPR001781 | 217 | 255 | PD000094 | Zinc finger | |
HMMPfam | IPR001781 | 31 | 87 | PF00412 | Zinc finger |
IPR001781 | 90 | 146 | PF00412 | Zinc finger | |
IPR001781 | 159 | 215 | PF00412 | Zinc finger | |
IPR001781 | 218 | 275 | PF00412 | Zinc finger | |
IPR003128 | 656 | 691 | PF02209 | Villin headpiece | |
HMMSmart | IPR001781 | 30 | 81 | SM00132 | Zinc finger |
IPR001781 | 89 | 141 | SM00132 | Zinc finger | |
IPR001781 | 158 | 209 | SM00132 | Zinc finger | |
IPR001781 | 217 | 269 | SM00132 | Zinc finger | |
IPR003128 | 656 | 691 | SM00153 | Villin headpiece | |
ProfileScan | IPR001781 | 29 | 88 | PS50023 | Zinc finger |
IPR001781 | 89 | 148 | PS50023 | Zinc finger | |
IPR001781 | 157 | 216 | PS50023 | Zinc finger | |
IPR001781 | 217 | 276 | PS50023 | Zinc finger | |
IPR003128 | 623 | 691 | PS51089 | Villin headpiece | |
ScanRegExp | IPR001781 | 31 | 64 | PS00478 | Zinc finger |
IPR001781 | 90 | 123 | PS00478 | Zinc finger | |
IPR001781 | 159 | 193 | PS00478 | Zinc finger | |
IPR001781 | 218 | 251 | PS00478 | Zinc finger |
![]() |
Primer_f | TCTGCTGTGTTCTCATGTAGG |
---|---|
Primer_r | AACCAGTGACAATAAGGCAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTGCTGTGTTCTCATGTAGG |
Primer_r | AACCAGTGACAATAAGGCAAC |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |