Order Kazusa clone(s) from : ![]() |
Product ID | ORK01995 |
---|---|
Accession No | AB018326 |
Description | PHD finger protein 14, transcript variant 2 |
Clone name | hk05408 |
Vector information | |
cDNA sequence | DNA sequence (4231 bp) Predicted protein sequence (899 aa) |
Flexi ORF Clone | FXC01995 |
Source | Human adult brain |
Rouge ID |
mKIAA0783
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1157 bp |
---|---|
Genome contig ID | gi89161213f_10880069 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (229740 - 229789) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 10980069 | 11109807 | 17 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 332 | 391 | PF00628 | Zinc finger |
IPR001965 | 738 | 790 | PF00628 | Zinc finger | |
HMMSmart | IPR001965 | 332 | 389 | SM00249 | Zinc finger |
IPR001965 | 451 | 510 | SM00249 | Zinc finger | |
IPR001965 | 738 | 788 | SM00249 | Zinc finger | |
ProfileScan | IPR001965 | 330 | 391 | PS50016 | Zinc finger |
IPR001965 | 736 | 790 | PS50016 | Zinc finger | |
ScanRegExp | IPR001965 | 333 | 388 | PS01359 | Zinc finger |
IPR001965 | 739 | 787 | PS01359 | Zinc finger |
![]() |
Primer_f | ATACCCTTCATGAGACCCAAC |
---|---|
Primer_r | TTCTATCCAAACCTGACAAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |