KIAA0852

Product ID	ORK01128
Accession No	AB020659
Description	MORC family CW-type zinc finger 2, transcript variant 3
Clone name	hk06101
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4467 bp) Predicted protein sequence (1017 aa)
HaloTag ORF Clone	FHC01128
Flexi ORF Clone	FXC01128
Source	Human adult brain
Rouge ID	mKIAA0852 by Kazusa Mouse cDNA Project

Length: 4467 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	190 bp
Genome contig ID	gi89161203r_29552600
PolyA signal sequence (TATAAA,-23)	+--------+--------+----*----+---- CTTCCTTAAGTTTATAAATATTTATTTTTTAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGATGCTGTGCCTGTGAGACCATACTTTTTTTTTTTTTTTTTTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	29652600	29694187	27	99.9	Perfect prediction

Length: 1017 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6X9	100.0	MORC family CW-...	Homo sapiens
XP_001110598	99.2	MORC family CW-...	Macaca mulatta
XP_515079	98.3	MORC family CW-...	Pan troglodytes
CAG30355	100.0	dJ430N8.1 [Homo...	Homo sapiens
XP_001494692	94.9	similar to MORC...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50926	7.6e-06	25.0	KIAA0136

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003594	9	89	PF02518	ATP-binding region
HMMPfam	IPR011124	479	528	PF07496	Zinc finger
ProfileScan	IPR011124	475	529	PS51050	Zinc finger

Primer_f	TGCAATTCCTACCAGAGCCGT
Primer_r	TTGATGTCTATGTCCTCCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GATGATGAGCTGGACGCCTAC
Primer_r	ATGTCCCGTGTAAGTCAAACC
PCR product length	167 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles