KIAA0853

Product ID	ORK07403
Accession No	AB020660
Description	zinc finger CCCH-type containing 13
Clone name	hk06136
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4363 bp) Predicted protein sequence (967 aa)
Source	Human adult brain
Rouge ID	mKIAA0853 by Kazusa Mouse cDNA Project

Length: 4363 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1457 bp
Genome contig ID	gi51511729r_45327819
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTACTAAGTGTTTTGAATAAAGAAAAAAAAAATGT
Flanking genome sequence (99987 - 99938)	----+--------+--------+--------+--------+----* ATGACCTCAGAGAATGAATACCCTTCAGGAAGCCACTTCCTGATTTTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	45427806	45447783	8	99.8	Perfect prediction

Length: 967 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5T200	0	99.9	Zinc finger CCC...	Homo sapiens
XP_001097211	0	98.0	zinc finger CCC...	Macaca mulatta
CAB66679	0	99.9	hypothetical pr...	Homo sapiens
CAM13064	0	99.8	zinc finger CCC...	Homo sapiens
BAG52030	9.9e-169	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018344	0.00016	26.7	KIAA0801
AB002322	0.00016	23.7	KIAA0324
D80004	0.00054	23.6	KIAA0182
AB014570	0.00094	21.9	KIAA0670

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	GGAAAATGGTTGTCACTGCTC
Primer_r	ACATACCACGCCAGCTAGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GATCATCCATACAGAACCAAC
Primer_r	ACATACCACGCCAGCTAGACC
PCR product length	129 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles