KIAA0863

Product ID	ORK00665
Accession No	AB020670
Description	ADNP homeobox 2
Clone name	hk06535
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4313 bp) Predicted protein sequence (1181 aa)
HaloTag ORF Clone	FHC00665
Flexi ORF Clone	FXC00665
Source	Human adult brain
Rouge ID	mKIAA0863 by Kazusa Mouse cDNA Project

Length: 4313 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	732 bp
Genome contig ID	gi51511735f_75868257
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGTTATTTTACAAATAAATTTATTCTGTAGATGC
Flanking genome sequence (130157 - 130206)	----+--------+--------+--------+--------+----* AGAAATATTTTTCAGTGTAGATTTTCCCTTTTGATATGCTAAGTCATTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	75968173	75998412	4	99.0	Perfect prediction

Length: 1181 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_512186	99.2	zinc finger pro...	Pan troglodytes
XP_001110872	97.8	similar to Acti...	Macaca mulatta
AAI66606	79.6	Adnp2 protein [...	Rattus norvegicus
XP_001496130	86.2	similar to ADNP...	Equus caballus
AAI47928	84.7	ADNP2 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018327	2.6e-05	26.3	KIAA0784

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR015880	123	146	SM00355	Zinc finger
	IPR015880	156	178	SM00355	Zinc finger
	IPR015880	205	228	SM00355	Zinc finger
	IPR015880	265	290	SM00355	Zinc finger
	IPR015880	744	766	SM00355	Zinc finger
	IPR015880	797	818	SM00355	Zinc finger
	IPR015880	820	843	SM00355	Zinc finger
	IPR015880	925	948	SM00355	Zinc finger
	IPR001356	1093	1155	SM00389	Homeobox
ProfileScan	IPR007087	820	848	PS50157	Zinc finger
ScanRegExp	IPR007087	822	843	PS00028	Zinc finger
ScanRegExp	IPR007087	927	949	PS00028	Zinc finger

Primer_f	TCGATCTCCTTCAGCTTTCCC
Primer_r	GAAGTCAGCGTAAGTTAATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCGATCTCCTTCAGCTTTCCC
Primer_r	GAAGTCAGCGTAAGTTAATGC
PCR product length	126 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles