Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00643 |
---|---|
Accession No | AB018341 |
Description | zinc finger protein 432 |
Clone name | hk06584 |
Vector information | |
cDNA sequence | DNA sequence (4517 bp) Predicted protein sequence (682 aa) |
HaloTag ORF Clone |
FHC00643
|
Flexi ORF Clone | FXC00643 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 235 | 258 | PD000003 | Zinc finger |
IPR007087 | 291 | 314 | PD000003 | Zinc finger | |
IPR007087 | 319 | 342 | PD000003 | Zinc finger | |
IPR007087 | 347 | 370 | PD000003 | Zinc finger | |
IPR007087 | 375 | 398 | PD000003 | Zinc finger | |
IPR007087 | 403 | 426 | PD000003 | Zinc finger | |
IPR007087 | 431 | 454 | PD000003 | Zinc finger | |
IPR007087 | 459 | 482 | PD000003 | Zinc finger | |
IPR007087 | 487 | 510 | PD000003 | Zinc finger | |
IPR007087 | 515 | 538 | PD000003 | Zinc finger | |
IPR007087 | 543 | 566 | PD000003 | Zinc finger | |
IPR007087 | 571 | 594 | PD000003 | Zinc finger | |
IPR007087 | 627 | 650 | PD000003 | Zinc finger | |
IPR007087 | 655 | 677 | PD000003 | Zinc finger | |
HMMPfam | IPR001909 | 38 | 78 | PF01352 | KRAB box |
IPR007087 | 235 | 257 | PF00096 | Zinc finger | |
IPR007087 | 263 | 285 | PF00096 | Zinc finger | |
IPR007087 | 291 | 313 | PF00096 | Zinc finger | |
IPR007087 | 319 | 341 | PF00096 | Zinc finger | |
IPR007087 | 347 | 369 | PF00096 | Zinc finger | |
IPR007087 | 375 | 397 | PF00096 | Zinc finger | |
IPR007087 | 403 | 425 | PF00096 | Zinc finger | |
IPR007087 | 431 | 453 | PF00096 | Zinc finger | |
IPR007087 | 459 | 481 | PF00096 | Zinc finger | |
IPR007087 | 487 | 509 | PF00096 | Zinc finger | |
IPR007087 | 515 | 537 | PF00096 | Zinc finger | |
IPR007087 | 543 | 565 | PF00096 | Zinc finger | |
IPR007087 | 571 | 593 | PF00096 | Zinc finger | |
IPR007087 | 599 | 621 | PF00096 | Zinc finger | |
IPR007087 | 627 | 649 | PF00096 | Zinc finger | |
IPR007087 | 655 | 677 | PF00096 | Zinc finger | |
HMMSmart | IPR001909 | 38 | 98 | SM00349 | KRAB box |
IPR015880 | 235 | 257 | SM00355 | Zinc finger | |
IPR015880 | 263 | 285 | SM00355 | Zinc finger | |
IPR015880 | 291 | 313 | SM00355 | Zinc finger | |
IPR015880 | 319 | 341 | SM00355 | Zinc finger | |
IPR015880 | 347 | 369 | SM00355 | Zinc finger | |
IPR015880 | 375 | 397 | SM00355 | Zinc finger | |
IPR015880 | 403 | 425 | SM00355 | Zinc finger | |
IPR015880 | 431 | 453 | SM00355 | Zinc finger | |
IPR015880 | 459 | 481 | SM00355 | Zinc finger | |
IPR015880 | 487 | 509 | SM00355 | Zinc finger | |
IPR015880 | 515 | 537 | SM00355 | Zinc finger | |
IPR015880 | 543 | 565 | SM00355 | Zinc finger | |
IPR015880 | 571 | 593 | SM00355 | Zinc finger | |
IPR015880 | 599 | 621 | SM00355 | Zinc finger | |
IPR015880 | 627 | 649 | SM00355 | Zinc finger | |
IPR015880 | 655 | 677 | SM00355 | Zinc finger | |
ProfileScan | IPR001909 | 38 | 109 | PS50805 | KRAB box |
IPR007087 | 235 | 262 | PS50157 | Zinc finger | |
IPR007087 | 263 | 290 | PS50157 | Zinc finger | |
IPR007087 | 291 | 318 | PS50157 | Zinc finger | |
IPR007087 | 319 | 346 | PS50157 | Zinc finger | |
IPR007087 | 347 | 374 | PS50157 | Zinc finger | |
IPR007087 | 375 | 402 | PS50157 | Zinc finger | |
IPR007087 | 403 | 430 | PS50157 | Zinc finger | |
IPR007087 | 431 | 458 | PS50157 | Zinc finger | |
IPR007087 | 459 | 486 | PS50157 | Zinc finger | |
IPR007087 | 487 | 514 | PS50157 | Zinc finger | |
IPR007087 | 515 | 542 | PS50157 | Zinc finger | |
IPR007087 | 543 | 570 | PS50157 | Zinc finger | |
IPR007087 | 571 | 598 | PS50157 | Zinc finger | |
IPR007087 | 599 | 626 | PS50157 | Zinc finger | |
IPR007087 | 627 | 654 | PS50157 | Zinc finger | |
IPR007087 | 655 | 682 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 237 | 257 | PS00028 | Zinc finger |
IPR007087 | 265 | 285 | PS00028 | Zinc finger | |
IPR007087 | 293 | 313 | PS00028 | Zinc finger | |
IPR007087 | 321 | 341 | PS00028 | Zinc finger | |
IPR007087 | 349 | 369 | PS00028 | Zinc finger | |
IPR007087 | 377 | 397 | PS00028 | Zinc finger | |
IPR007087 | 405 | 425 | PS00028 | Zinc finger | |
IPR007087 | 433 | 453 | PS00028 | Zinc finger | |
IPR007087 | 461 | 481 | PS00028 | Zinc finger | |
IPR007087 | 489 | 509 | PS00028 | Zinc finger | |
IPR007087 | 517 | 537 | PS00028 | Zinc finger | |
IPR007087 | 545 | 565 | PS00028 | Zinc finger | |
IPR007087 | 573 | 593 | PS00028 | Zinc finger | |
IPR007087 | 599 | 621 | PS00028 | Zinc finger | |
IPR007087 | 629 | 649 | PS00028 | Zinc finger | |
IPR007087 | 657 | 677 | PS00028 | Zinc finger |
RT-PCR-ELISA |
Primer_f | GAACTTACACATACTAGCAGC |
---|---|
Primer_r | CATGTATCACTGAAATCCTCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAACTTACACATACTAGCAGC |
Primer_r | CATGTATCACTGAAATCCTCG |
PCR product length | 137 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |