KIAA0873

Product ID	ORK00667
Accession No	AB020680
Description	BCL2-associated athanogene 5, transcript variant 2
Clone name	hk07246
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4119 bp) Predicted protein sequence (466 aa)
HaloTag ORF Clone	FHC00667
Flexi ORF Clone	FXC00667
Source	Human adult brain
Rouge ID	mKIAA0873 by Kazusa Mouse cDNA Project

Length: 4119 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2718 bp
Genome contig ID	gi51511730r_102993192
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- GGTCTGCATTAAACGCTGTAGTCCATGTTCATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATGGCTGGGAACGTTTGCTTTATTTACATTCAGTCAGCGTTGCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	103093192	103098734	2	99.0	Perfect prediction

Length: 466 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH44216	1.8e-176	99.1	BAG5 protein [H...	Homo sapiens
Q9UL15	1.3e-171	100.0	BAG family mole...	Homo sapiens
AAH50551	1.7e-170	99.8	BCL2-associated...	Homo sapiens
BAE02324	4.1e-170	98.9	unnamed protein...	Macaca fascicularis
XP_537562	6.6e-170	95.7	similar to BCL2...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003103	28	105	PF02179	Apoptosis regulator Bcl-2 protein
	IPR003103	201	279	PF02179	Apoptosis regulator Bcl-2 protein
	IPR003103	294	369	PF02179	Apoptosis regulator Bcl-2 protein
	IPR003103	384	461	PF02179	Apoptosis regulator Bcl-2 protein
HMMSmart	IPR003103	28	105	SM00264	Apoptosis regulator Bcl-2 protein
	IPR003103	201	279	SM00264	Apoptosis regulator Bcl-2 protein
	IPR003103	294	369	SM00264	Apoptosis regulator Bcl-2 protein
	IPR003103	384	461	SM00264	Apoptosis regulator Bcl-2 protein
ProfileScan	IPR003103	28	105	PS51035	Apoptosis regulator Bcl-2 protein
	IPR003103	201	279	PS51035	Apoptosis regulator Bcl-2 protein
	IPR003103	294	369	PS51035	Apoptosis regulator Bcl-2 protein
	IPR003103	384	461	PS51035	Apoptosis regulator Bcl-2 protein

Primer_f	CACCGGATTTAGCTCTTGTCG
Primer_r	ATGGACTACAGCGTTTAATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-