Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00670 |
---|---|
Accession No | AB020688 |
Description | TAO kinase 2, transcript variant 2 |
Clone name | hk07534 |
Vector information | |
cDNA sequence | DNA sequence (4242 bp) Predicted protein sequence (1064 aa) |
HaloTag ORF Clone |
FHC00670
|
Flexi ORF Clone | FXC00670 |
Source | Human adult brain |
Rouge ID |
mKIAA0881
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 689 bp |
---|---|
Genome contig ID | gi51511732f_29793103 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (117979 - 118028) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 29893103 | 29911080 | 19 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 46 | 286 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 43 | 296 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 43 | 295 | SM00219 | Tyrosine protein kinase |
IPR002290 | 43 | 296 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 43 | 296 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 49 | 73 | PS00107 | Protein kinase |
IPR008271 | 162 | 174 | PS00108 | Serine/threonine protein kinase |
RT-PCR-ELISA |
Primer_f | CTAGGAAAGGAGGGAGATGTG |
---|---|
Primer_r | AGACAGTTACGGGAAGAGACC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTAGGAAAGGAGGGAGATGTG |
Primer_r | AGACAGTTACGGGAAGAGACC |
PCR product length | 244 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |