KIAA0881

Product ID	ORK00670
Accession No	AB020688
Description	TAO kinase 2, transcript variant 2
Clone name	hk07534
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4242 bp) Predicted protein sequence (1064 aa)
HaloTag ORF Clone	FHC00670
Flexi ORF Clone	FXC00670
Source	Human adult brain
Rouge ID	mKIAA0881 by Kazusa Mouse cDNA Project

Length: 4242 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	689 bp
Genome contig ID	gi51511732f_29793103
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGGCAAGCTTTTAATAAACTGTTGGTTATTCTAAC
Flanking genome sequence (117979 - 118028)	----+--------+--------+--------+--------+----* AGATCTCAGGACTCACCCTTCTGTCTTTGGTGTGCGTGAAGGACTGCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	29893103	29911080	19	99.7	Perfect prediction

Length: 1064 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG38503	100.0	STE20-like kina...	Homo sapiens
XP_858335	99.6	similar to TAO ...	Canis lupus fam...
XP_872869	99.2	similar to TAO ...	Bos taurus
Q6ZQ29	98.0	Serine/threonin...	Mus musculus
XP_858414	98.1	similar to TAO ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037782	4.1e-48	70.4	KIAA1361
D86959	2.2e-11	24.7	KIAA0204
AB011123	4.5e-09	32.6	KIAA0551
AB032968	5.3e-09	36.2	KIAA1142
AB014587	1.8e-08	29.9	KIAA0687

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	46	286	PD000001	Protein kinase
HMMPfam	IPR000719	43	296	PF00069	Protein kinase
HMMSmart	IPR001245	43	295	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	43	296	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	43	296	PS50011	Protein kinase
ScanRegExp	IPR000719	49	73	PS00107	Protein kinase
ScanRegExp	IPR008271	162	174	PS00108	Serine/threonine protein kinase

Primer_f	CTAGGAAAGGAGGGAGATGTG
Primer_r	AGACAGTTACGGGAAGAGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTAGGAAAGGAGGGAGATGTG
Primer_r	AGACAGTTACGGGAAGAGACC
PCR product length	244 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles