Order Kazusa clone(s) from : ![]() |
Product ID | ORK06251 |
---|---|
Accession No | AB029024 |
Description | oxidative stress responsive 1 |
Clone name | hk08029 |
Vector information | |
cDNA sequence | DNA sequence (4272 bp) Predicted protein sequence (467 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1101
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2593 bp |
---|---|
Genome contig ID | gi89161205f_38082290 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (189691 - 189740) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 38182273 | 38271979 | 18 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 3 | 231 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 3 | 231 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 3 | 231 | SM00219 | Tyrosine protein kinase |
IPR002290 | 3 | 231 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 1 | 231 | PS50011 | Protein kinase |
![]() |
Primer_f | CAGGTTCCAGTGGGCGTCTTC |
---|---|
Primer_r | AGACCTGAGTTGTGAAATTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |