KIAA1101

Product ID	ORK06251
Accession No	AB029024
Description	oxidative stress responsive 1
Clone name	hk08029
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4272 bp) Predicted protein sequence (467 aa)
Source	Human adult brain
Rouge ID	mKIAA1101 by Kazusa Mouse cDNA Project

Length: 4272 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2593 bp
Genome contig ID	gi89161205f_38082290
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTCTTCATTTTTAATCAATAAAGAGTAAATTGTC
Flanking genome sequence (189691 - 189740)	----+--------+--------+--------+--------+----* CTTAGTGGTGTATGGACGCTTTATTTTAGTGGCCGTTGGCGGAGAGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	38182273	38271979	18	99.4	Perfect prediction

Length: 467 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95747	5.4e-164	100.0	Serine/threonin...	Homo sapiens
AAQ02425	5.4e-164	100.0	oxidative-stres...	synthetic construct
XP_526174	2.6e-163	99.6	hypothetical pr...	Pan troglodytes
Q5R495	3.8e-163	99.4	Serine/threonin...	Pongo abelii
EAW64525	9.9e-163	100.0	oxidative-stres...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86959	3.5e-21	29.5	KIAA0204
AB011123	1.2e-18	39.2	KIAA0551
AB014587	2.6e-18	39.0	KIAA0687
AB032968	9e-12	39.7	KIAA1142
AB020688	2.7e-11	33.1	KIAA0881

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	3	231	PD000001	Protein kinase
HMMPfam	IPR000719	3	231	PF00069	Protein kinase
HMMSmart	IPR001245	3	231	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	3	231	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1	231	PS50011	Protein kinase

Primer_f	CAGGTTCCAGTGGGCGTCTTC
Primer_r	AGACCTGAGTTGTGAAATTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-