KIAA0997

Product ID	ORK00711
Accession No	AB023214
Description	zinc finger and BTB domain containing 1, transcript variant 2
Clone name	hk08613
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3990 bp) Predicted protein sequence (646 aa)
HaloTag ORF Clone	FHC00711
Flexi ORF Clone	FXC00711
Source	Human adult brain

Length: 3990 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1793 bp
Genome contig ID	gi51511730f_63941174
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ACCTAATAAAATTTCCTCCTCTATATTCCAAAGTT
Flanking genome sequence (128989 - 129038)	----+--------+--------+--------+--------+----* AAATTGTCTGTATATTACTTTTATTTATACTGTATTTTTTCCAATCTGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	64041174	64070161	3	99.1	Perfect prediction

Length: 646 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAT06732	100.0	L2 [Homo sapiens].	Homo sapiens
EAW80863	99.8	zinc finger and...	Homo sapiens
XP_001499240	97.5	zinc finger and...	Equus caballus
Q9Y2K1	99.8	Zinc finger and...	Homo sapiens
AAH50719	99.7	ZBTB1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002352	1e-05	20.4	KIAA0354
AB028943	0.00011	24.0	KIAA1020
AB007901	0.00012	21.4	KIAA0441

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	16	122	PF00651	BTB/POZ
	IPR007087	536	558	PF00096	Zinc finger
	IPR007087	608	630	PF00096	Zinc finger
HMMSmart	IPR000210	26	123	SM00225	BTB/POZ-like
	IPR015880	218	244	SM00355	Zinc finger
	IPR015880	423	445	SM00355	Zinc finger
	IPR015880	536	556	SM00355	Zinc finger
	IPR015880	580	602	SM00355	Zinc finger
	IPR015880	608	630	SM00355	Zinc finger
ProfileScan	IPR000210	26	93	PS50097	BTB/POZ-like
	IPR007087	580	607	PS50157	Zinc finger
	IPR007087	608	635	PS50157	Zinc finger
ScanRegExp	IPR007087	582	602	PS00028	Zinc finger
ScanRegExp	IPR007087	610	630	PS00028	Zinc finger

Primer_f	GTCCTTCAGCAGCTAAACAAC
Primer_r	TAGAACTGCCTTGTGTGCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	GTCCTTCAGCAGCTAAACAAC
Primer_r	TAGAACTGCCTTGTGTGCTTG
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles