KIAA0898

Product ID	ORK07202
Accession No	AB020705
Description	tripartite motif containing 37, transcript variant 1
Clone name	hk09541
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4111 bp) Predicted protein sequence (979 aa)
Source	Human adult brain
Rouge ID	mKIAA0898 by Kazusa Mouse cDNA Project

Length: 4111 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1171 bp
Genome contig ID	gi51511734r_54330349
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TAGTTTGCACTTTTTGTTAATAAAATCAACTTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATATGCCTCTGCTGTTTATTAAATTGGGACCAGAAACCCCTTCTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	54430349	54538649	24	100.0	Perfect prediction

Length: 979 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511914	99.6	tripartite moti...	Pan troglodytes
O94972	100.0	Tripartite moti...	Homo sapiens
BAF85148	99.9	unnamed protein...	Homo sapiens
AAH36012	99.9	Tripartite moti...	Homo sapiens
AAL36460	99.9	POB1 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029021	4.7e-05	23.4	KIAA1098
AB011089	0.00087	23.3	KIAA0517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	118	135	PR01406	Zinc finger
FPrintScan	IPR000315	138	152	PR01406	Zinc finger
HMMPfam	IPR000315	105	147	PF00643	Zinc finger
HMMPfam	IPR002083	298	406	PF00917	MATH
HMMSmart	IPR000315	105	147	SM00336	Zinc finger
	IPR003649	147	269	SM00502	B-box
	IPR002083	296	399	SM00061	MATH
ProfileScan	IPR001841	30	70	PS50089	Zinc finger
	IPR000315	105	147	PS50119	Zinc finger
	IPR002083	291	418	PS50144	MATH

Primer_f	AACTTTGCCATTGTGCTCCTG
Primer_r	GCATTCAGCAAGACATCAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-