KIAA0809

Product ID	ORK06581
Accession No	AB018352
Description	RAD54-like 2 (S. cerevisiae)
Clone name	hk10195
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4332 bp) Predicted protein sequence (1385 aa)
Source	Human adult brain
Rouge ID	mKIAA0809 by Kazusa Mouse cDNA Project
Note	We replaced hk05250, former representative clones for KIAA0809 with hk10195. (2002/5/10)

Length: 4332 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	174 bp
Genome contig ID	gi89161205f_51536716
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGGCAGAGCTCTGTTGCTGTTTAACAAAAGAGGC
Flanking genome sequence (135936 - 135985)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAGTCCAACACAGCAGCAATAGCGGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	51636716	51672650	20	99.7	Perfect prediction

Length: 1385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4B4	100.0	Helicase ARIP4;...	Homo sapiens
EAW65148	99.9	hCG1997495, iso...	Homo sapiens
NP_055921	99.9	RAD54-like 2 [H...	Homo sapiens
XP_001169759	99.8	RAD54-like 2 is...	Pan troglodytes
XP_001096767	98.8	similar to RAD5...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	2.7e-06	23.9	KIAA0309
AB037756	9.9e-06	31.3	KIAA1335
AB037837	1e-05	26.2	KIAA1416
AB046784	1.2e-05	24.0	KIAA1564
AB033085	1.3e-05	24.8	KIAA1259

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	192	546	PF00176	SNF2-related
HMMPfam	IPR001650	692	772	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	185	438	SM00487	DEAD-like helicases
HMMSmart	IPR001650	669	772	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	210	430	PS51192	Helicase
ProfileScan	IPR001650	646	814	PS51194	DNA/RNA helicase

Primer_f	CACTCCCATTCTCACAGCCAC
Primer_r	GCCTGGATAGATAGACATGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CACACGCCAGCCAAAACAGTC
Primer_r	CTTCTTCAGGCTTGTTGTCAG
PCR product length	124 (0.3k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles