Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06581 |
---|---|
Accession No | AB018352 |
Description | RAD54-like 2 (S. cerevisiae) |
Clone name | hk10195 |
Vector information | |
cDNA sequence | DNA sequence (4332 bp) Predicted protein sequence (1385 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0809
by Kazusa Mouse cDNA Project
|
Note | We replaced hk05250, former representative clones for KIAA0809 with hk10195. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 174 bp |
---|---|
Genome contig ID | gi89161205f_51536716 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135936 - 135985) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 51636716 | 51672650 | 20 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000330 | 192 | 546 | PF00176 | SNF2-related |
IPR001650 | 692 | 772 | PF00271 | DNA/RNA helicase | |
HMMSmart | IPR014001 | 185 | 438 | SM00487 | DEAD-like helicases |
IPR001650 | 669 | 772 | SM00490 | DNA/RNA helicase | |
ProfileScan | IPR014021 | 210 | 430 | PS51192 | Helicase |
IPR001650 | 646 | 814 | PS51194 | DNA/RNA helicase |
RT-PCR-ELISA |
Primer_f | CACTCCCATTCTCACAGCCAC |
---|---|
Primer_r | GCCTGGATAGATAGACATGCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACACGCCAGCCAAAACAGTC |
Primer_r | CTTCTTCAGGCTTGTTGTCAG |
PCR product length | 124 (0.3k) bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |