Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00088 |
---|---|
Accession No | AB007950 |
Description | transmembrane and coiled-coil domain family 2, transcript variant 1 |
Clone name | hm00132 |
Vector information | |
cDNA sequence | DNA sequence (3998 bp) Predicted protein sequence (732 aa) |
HaloTag ORF Clone |
FHC00088
|
Flexi ORF Clone | FXC00088 |
Source | Human adult brain |
Rouge ID |
mKIAA0481
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01480 and hh01480s1, former representative clones for KIAA0481 with hm00132. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1213 bp |
---|---|
Genome contig ID | gi89161185f_203363661 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (145429 - 145478) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 203463661 | 203509088 | 5 | 99.6 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 667 | GKFINVILALMAVLLVFVSTIAN | 689 | PRIMARY | 23 | 2 | 705 | TLLVLVLFLLWKHWDSLTYLLEH | 727 | SECONDARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCAGGAAGGTGCACAACAGC |
Primer_r | GCTCTGGAGTGTTGTGTATGG |
PCR product length | 146 bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |