Order Kazusa clone(s) from : ![]() |
Product ID | ORK00088 |
---|---|
Accession No | AB007950 |
Description | transmembrane and coiled-coil domain family 2, transcript variant 1 |
Clone name | hm00132 |
Vector information | |
cDNA sequence | DNA sequence (3998 bp) Predicted protein sequence (732 aa) |
HaloTag ORF Clone |
FHC00088
![]() |
Flexi ORF Clone | FXC00088 |
Source | Human adult brain |
Rouge ID |
mKIAA0481
by Kazusa Mouse cDNA Project
|
Note | We replaced hh01480 and hh01480s1, former representative clones for KIAA0481 with hm00132. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1213 bp |
---|---|
Genome contig ID | gi89161185f_203363661 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (145429 - 145478) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 203463661 | 203509088 | 5 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 667 | GKFINVILALMAVLLVFVSTIAN | 689 | PRIMARY | 23 | 2 | 705 | TLLVLVLFLLWKHWDSLTYLLEH | 727 | SECONDARY | 23 |
---|
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTCAGGAAGGTGCACAACAGC |
Primer_r | GCTCTGGAGTGTTGTGTATGG |
PCR product length | 146 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |