KIAA1131

Product ID	ORK05410
Accession No	AB032957
Description	HECT domain containing E3 ubiquitin protein ligase 1
Clone name	pf08614
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7320 bp) Predicted protein sequence (2168 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1131 by Kazusa Mouse cDNA Project
Note	We replaced hh01054, former representative clones for KIAA1131 with pf08614. (2005/08/06)

Length: 7320 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	812 bp
Genome contig ID	gi51511730r_30539075
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATGCTCAACAATAATCATTAAAATGTTTGCAGCGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAGAACTGTGTCATGTGACTATTTCAATGCAGTCATCAGACTTAAGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	30639075	30708431	35	99.9	Perfect prediction

Length: 2168 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65950	100.0	HECT domain con...	Homo sapiens
NP_056197	99.9	HECT domain con...	Homo sapiens
XP_001489913	99.7	HECT domain con...	Equus caballus
NP_659037	98.8	HECT domain con...	Mus musculus
XP_001114983	99.3	similar to HECT...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D28476	7.2e-18	30.4	KIAA0045
AB037741	2e-11	32.9	KIAA1320
D13635	3.1e-10	32.7	KIAA0010
AB007899	3.5e-10	32.4	KIAA0439
AB002310	1e-08	33.3	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	18	30	PR01415	Ankyrin
FPrintScan	IPR002110	30	42	PR01415	Ankyrin
HMMPfam	IPR002110	1	16	PF00023	Ankyrin
	IPR002110	17	52	PF00023	Ankyrin
	IPR012919	665	798	PF07738	Sad1/UNC-like
	IPR010606	835	896	PF06701	Mib_herc2
	IPR000569	1737	2168	PF00632	HECT
HMMSmart	IPR000569	1701	2168	SM00119	HECT
ProfileScan	IPR002110	1	41	PS50297	Ankyrin
ProfileScan	IPR000569	1709	2168	PS50237	HECT

Primer_f	GCCTCAAGAGCAATAGTATGG
Primer_r	ATTCTCAGCCCATTCCATCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTTTTAATGATGGCCTGCAC
Primer_r	GCACTTAGACCAGGTTTTCCC
PCR product length	204 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles