KIAA1727

Product ID	ORK05705
Accession No	AB051514
Description	FH2 domain containing 1
Clone name	pg00153
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6356 bp) Predicted protein sequence (1130 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1727 by Kazusa Mouse cDNA Project

Length: 6356 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2962 bp
Genome contig ID	gi89161207f_153983698
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAGTTCCTGTTTATGAGAGTCATGTTTCATCTC
Flanking genome sequence (136592 - 136641)	----+--------+--------+--------+--------+----* AGCTTCTTCCATGGATGTGTCTGTGTGATCTTGCTGGGAGAGTATTCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	154083698	154120288	11	99.2	Perfect prediction

Length: 1130 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001085372	0	94.7	similar to form...	Macaca mulatta
EDM00822	0	72.2	similar to CG32...	Rattus norvegicus
Q3ULZ2	4.4e-216	72.2	FH2 domain-cont...	Mus musculus
EDL15405	6.4e-216	72.2	RIKEN cDNA 6330...	Mus musculus
BAE26306	7.8e-216	72.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014566	6.8e-10	27.3	KIAA0666
AB095934	1.6e-09	28.7	KIAA2014
AB051482	2.2e-05	24.2	KIAA1695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015425	75	444	PF02181	Actin-binding FH2
HMMSmart	IPR003104	74	514	SM00498	Actin-binding FH2 and DRF autoregulatory

Primer_f	CTGTTGCCTGTCATCTAAGCG
Primer_r	TTGTGGAGCCCTGGAAATACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CTGTTGCCTGTCATCTAAGCG
Primer_r	TTGTGGAGCCCTGGAAATACC
PCR product length	152 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles