KIAA1410

Product ID	ORK00827
Accession No	AB037831
Description	dynein, axonemal, heavy chain 1
Clone name	pg00933y4
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (13104 bp) Predicted protein sequence (4293 aa)
Flexi ORF Clone	FXC00827
Source	Human brain (hippocampus)
Note	We replaced pg00933y2 and fh06675, former representative clones for KIAA1410 with pg00933y4. (2008/8/27,2003/4/2)

Length: 13104 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	45 bp
Genome contig ID	gi89161205f_52225375
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AAGGGCTGGGGCCATTAAAGCTGAATTTTCTAAGC
Flanking genome sequence (184174 - 184223)	----+--------+--------+--------+--------+----* AGTCCAGCTGTGCCTTAGCTGCTTGCATGAGGACCCCTCTGCAGGACTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	52325375	52409547	78	100.0	Perfect prediction

Length: 4293 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056327	100.0	dynein, axonema...	Homo sapiens
Q9P2D7	98.5	Dynein heavy ch...	Homo sapiens
EAW65217	96.9	dynein, axonema...	Homo sapiens
XP_001085984	97.0	similar to dyne...	Macaca mulatta
EAW65219	95.7	dynein, axonema...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023161	0	44.1	KIAA0944
AB046823	1.1e-136	34.9	KIAA1603
AB040936	3.1e-80	38.6	KIAA1503
AB051484	2.3e-67	41.5	KIAA1697
AB082528	5e-63	26.0	KIAA1997

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	1039	1449	PF08393	Dynein heavy chain
	IPR011704	1885	2039	PF07728	ATPase associated with various cellular activities
	IPR011704	2250	2397	PF07728	ATPase associated with various cellular activities
	IPR004273	3582	4290	PF03028	Dynein heavy chain

Primer_f	CTGGGGCGCAACTTTATCTTC
Primer_r	CCACTAGGTTCTTGAAGGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATCGAGGTGCTGTCTGTGGTG
Primer_r	AGATTGTCAGGCAGCTCCGTG
PCR product length	173(800) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles