KIAA1813

Product ID	ORK00925
Accession No	AB058716
Description	leucine zipper, putative tumor suppressor 2
Clone name	ph00819b
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5733 bp) Predicted protein sequence (673 aa)
HaloTag ORF Clone	FHC00925
Flexi ORF Clone	FXC00925
Source	Human brain (hippocampus)
Rouge ID	mKIAA1813 by Kazusa Mouse cDNA Project

Length: 5733 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	660 bp
Genome contig ID	gi89161187f_102649223
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACCCAAAGAAAAAATTAAAAAAAATTTTTTTGTTT
Flanking genome sequence (108354 - 108403)	----+--------+--------+--------+--------+----* AAAAATAATGTGAATGTGCTGGATAAAGAGTACAGGAACTTGTTTGACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	102749223	102757575	4	99.2	Perfect prediction

Length: 673 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BRK4	3.5e-180	100.0	Leucine zipper ...	Homo sapiens
AAH58938	5.1e-180	99.9	LZTS2 protein [...	Homo sapiens
XP_001109715	3.7e-178	99.0	similar to leuc...	Macaca mulatta
AAK31577	2.5e-173	100.0	LAPSER1 [Homo s...	Homo sapiens
XP_001500106	1.7e-171	95.1	leucine zipper,...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011124	2.7e-19	38.9	KIAA0552
AB002339	0.001	32.4	KIAA0341

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	443	641	PF06818	Fez1

Primer_f	CCAGCTTCACCTACATCAATG
Primer_r	AGACAGGGATGAGCTTTGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-