Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01174 |
---|---|
Accession No | AB040964 |
Description | adhesion G protein-coupled receptor A2 |
Clone name | ph00937 |
Vector information | |
cDNA sequence | DNA sequence (5350 bp) Predicted protein sequence (1206 aa) |
HaloTag ORF Clone |
FHC01174
|
Flexi ORF Clone | FXC01174 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1531
by Kazusa Mouse cDNA Project
|
Note | We replaced hj08219, former representative clones for KIAA1531 with ph00937. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1621 bp |
---|---|
Genome contig ID | gi51511724f_37673582 |
PolyA signal sequence (ATTAAA,-32) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (147072 - 147121) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 37773582 | 37820652 | 16 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001611 | 195 | 208 | PR00019 | Leucine-rich repeat |
IPR001611 | 216 | 229 | PR00019 | Leucine-rich repeat | |
HMMPfam | IPR001611 | 170 | 192 | PF00560 | Leucine-rich repeat |
IPR001611 | 194 | 216 | PF00560 | Leucine-rich repeat | |
IPR001611 | 218 | 240 | PF00560 | Leucine-rich repeat | |
IPR001611 | 242 | 264 | PF00560 | Leucine-rich repeat | |
IPR001879 | 452 | 506 | PF02793 | Hormone receptor | |
HMMSmart | IPR003591 | 167 | 191 | SM00369 | Leucine-rich repeat |
IPR003591 | 192 | 215 | SM00369 | Leucine-rich repeat | |
IPR003591 | 216 | 239 | SM00369 | Leucine-rich repeat | |
IPR003591 | 240 | 263 | SM00369 | Leucine-rich repeat | |
IPR000483 | 275 | 325 | SM00082 | Cysteine-rich flanking region | |
IPR003599 | 338 | 431 | SM00409 | Immunoglobulin subtype | |
ProfileScan | IPR007110 | 345 | 429 | PS50835 | Immunoglobulin-like |
IPR001879 | 412 | 506 | PS50227 | Hormone receptor | |
IPR000832 | 637 | 812 | PS50261 | GPCR | |
ScanRegExp | IPR000832 | 929 | 944 | PS00650 | GPCR |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 637 | LHPVVYPCTALLLLCLFATIITY | 659 | PRIMARY | 23 | 2 | 674 | HMLLNLCFHIAMTSAVFAGGITL | 696 | SECONDARY | 23 | 3 | 751 | PMLRFYLIAGGIPLIICGITAAV | 773 | SECONDARY | 23 | 4 | 796 | FYIPVALILLITWIYFLCAGLR | 817 | PRIMARY | 22 | 5 | 884 | GVQLGALVTTHFLYLAMWACGAL | 906 | SECONDARY | 23 | 6 | 916 | VVCSCLYGVAASALGLFVFTHHC | 938 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TCATTTGATCTCCAGCTCCAC |
---|---|
Primer_r | TGGTCCTGTAGTGAAATGCTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |