KIAA2029

Product ID	ORK04042
Accession No	AB095949
Description	ADAM metallopeptidase with thrombospondin type 1 motif, 16
Clone name	pj01256
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4234 bp) Predicted protein sequence (1021 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA2029 by Kazusa Mouse cDNA Project

Length: 4234 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1166 bp
Genome contig ID	gi51511721f_5135263
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GAAGTTTTATAATAAAGTTTATATGGTACAGTGTG
Flanking genome sequence (238156 - 238205)	----+--------+--------+--------+--------+----* CTTCTGAACTACCTCATGATTCTTCACAAGGTTTGTTTCTGAAATCAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	5235263	5373417	20	100.0	Perfect prediction

Length: 1021 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI40298	99.9	ADAM metallopep...	synthetic construct
Q8TE57	99.9	A disintegrin a...	Homo sapiens
XP_001082662	98.3	ADAM metallopep...	Macaca mulatta
XP_545184	88.1	similar to ADAM...	Canis lupus fam...
XP_001501379	88.0	similar to ADAM...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037733	5.6e-82	33.3	KIAA1312
AB002364	4.9e-60	33.6	KIAA0366
AB037767	4.2e-44	35.0	KIAA1346
AB014588	1.7e-34	35.6	KIAA0688
AB011177	8.8e-28	25.0	KIAA0605

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	392	410	PR01857	Peptidase M12B
	IPR013273	503	522	PR01857	Peptidase M12B
	IPR013273	523	542	PR01857	Peptidase M12B
HMMPfam	IPR001590	89	292	PF01421	Peptidase M12B
	IPR000884	387	437	PF00090	Thrombospondin
	IPR010294	543	655	PF05986	ADAM-TS Spacer 1
	IPR000884	731	783	PF00090	Thrombospondin
	IPR000884	790	844	PF00090	Thrombospondin
	IPR000884	852	898	PF00090	Thrombospondin
	IPR000884	925	977	PF00090	Thrombospondin
	IPR010909	986	1018	PF08686	PLAC
HMMSmart	IPR000884	386	438	SM00209	Thrombospondin
	IPR000884	671	720	SM00209	Thrombospondin
	IPR000884	727	784	SM00209	Thrombospondin
	IPR000884	786	845	SM00209	Thrombospondin
	IPR000884	851	912	SM00209	Thrombospondin
	IPR000884	926	978	SM00209	Thrombospondin
ProfileScan	IPR001590	87	292	PS50215	Peptidase M12B
	IPR000884	383	438	PS50092	Thrombospondin
	IPR000884	724	784	PS50092	Thrombospondin
	IPR000884	785	845	PS50092	Thrombospondin
	IPR000884	848	912	PS50092	Thrombospondin
	IPR000884	924	978	PS50092	Thrombospondin
	IPR010909	983	1020	PS50900	PLAC
ScanRegExp	IPR006130	421	428	PS00097	Aspartate/ornithine carbamoyltransferase

Primer_f	AACTCAGCCTGCACGATTCAC
Primer_r	CAGTGCCCATTCAGGTAGTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-